Description :
From Genome Similarity Track
Location :
Scaffold_612:10319- 11459
Sequence
1140 bases(100 bases per row)
GCGTTCGCCGTTGATGCAAAAACTGGATGCTGGTGTCATTTCGCTGATTGTGGTGGTGGCGAGCGACCGTGTGATGTGGCTGGTGGAGGTGGCATGAGTC
GCATGGAGAACCATTCTCACTGTGTTGATGGTGCTCGCGGTTGTTTGTTGTGTTCACGTGAACCCGTCGTATCTCCATGACCCCACGCCAGGTGGATCAA
AAGAGTAGCGAGCGTAAATCCGAAACGCTGCCTCAGGANNNNNNNNNNAGGCGTGTATTCCGTTCGAGGAATGAACTAATGTAAGGGGATTGGAGGCTGT
TTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTGAGATCTTTCAAGACGCCGAGA
TTTCTCAGCAAACTCTGTATGGACGCGCACACGTTTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTAGTAGTAGCGCGCCGGCCGGTTGAACTTGGTCTCCACGCCCGCGTGGAGCGACTTGCCGTCCTGGCTCGTGAGCGCGACNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN