Description :
From Genome Similarity Track
Location :
contig_46:103185- 104634
Transcript NameFunction/comments
g10047.t1hypothetical protein

Sequence
1449 bases(100 bases per row)
AACGTCGCCTGCTCGGTGGTTGCGTTGACGAGCAGTGTCGGGGGCGAGAACTTGCCGTTGGGGTCCCATGAGTCATTCTGCGCGCTAACAAGTGTATCTC
CTCCAAAAAGAAGCTGGACGCACAGTCCAGCCAAAACTAGCACGGAGCGGCGGGAGGCGGAAGGCGCCTTACAGGAAGGCGATATCTGTCGGATGCTCAT
CGTGAGATGAGATGAGAACTGGGAGTCTTCAAGCCTGCGGCGGGGTCCGACCAACGTGGCATTTTACTCCGTCGGGATCTCTCTGCGCCCCGCAGCATCG
CGTGCTTCGCCACCAAGCCAGAAACGAAGAGCTCTTCAAATAGGTGCGTAAAACGCCTTGGTGCTCGCTCATTATTCAGGTTTCACTGAGCGCCCTGCAC
TCCAAAATTACATATGTGTCAGCCAGCCAAGGCGATTCAGCTCGAAATTCGCCGTTCGTTTCGCCATTGGAGAGAGCTCTCCTCTTGTCACAAGGAACAC
GACTGGACAAGTAAAAGTGCGATGGTGGAAGCGTCCTCGCAGCTTCTCAGAGAAGGTTCTGCCCCCGCGAGCAACGCGAAGTGAGCGTTGAGGCAGCAAA
CACGTCGCACCCCTGCAGTGAGAGACATCCTTTTGCCTTGAGGCAAGCCATCTAGTTGAATACTGAAGCATGTCAGTCAGTGCTCATGTGGCGGCAAGTT
GAGTCCGAATCCCCCACCATAGAATTTCTTACCGCTGCAAATCAATTCGAGAGTGCCATTATAACGCTGCTATCCAGCATCTTGGCAGCCAATACACTCG
GTAATCCTACGACAGGCCGCAGGTCAACGTTGTCAACGCCGTCGTCCTGCAAATTGTCGCCACGACCAAGAAGAATACCAAAGCAAAACAGCGCACCCAG
CCACTACCTGACGAAGTTGAAGTTCTCTTGAGCTCGTTCTGCCTTTTCCTCCAATCAGATCATCTTATCCAGGAATAAAAACGCACCTTCCTCGATACAA
AACCAACAAAAAGCCCCGCCCCGCCCCCTCCGCCCCCATGAGCGAGCGCGCGGCCGACGGCGCCTCCAAGCCGCCCAAAGAGCCCGCGGCCCAGCTCAGC
GTGGACGACGAGATCGCGACCGTCATGACCACGGCGTCCACCACCAAGAAGAAGGAGGACATGCGCAACGATAGCACGGGCATCACCGTGGGGGACTCGG
CCCACACGCTGTCGGACGTGCGTGCTGACGGCTTAAAAAATCGTCGCAGAAGAAGAACGAGGAGAACTGACTGTTTTTTTTAATTTTATTTTACGATCTT
TTCTTTCAGGGCAAAACGATCCACTACTCTGCAGAGCGGATCATCGGCAATGGCTCGTTCGGCGTCGTGTTCCAAGCTCAGTGGAAGAGACGGGCGAGAT
CGTCGCCATCAAGAAGGTGCTGCAAGACAAACGCTTCAAGGTGGGGGAA