Description :
From Genome Similarity Track
Location :
contig_46:103175- 105181
Transcript NameFunction/comments
g10047.t1hypothetical protein

Sequence
2006 bases(100 bases per row)
GGGCTTGCAGAACGTCGCCTGCTCGGTGGTTGCGTTGACGAGCAGTGTCGGGGGCGAGAACTTGCCGTTGGGGTCCCATGAGTCATTCTGCGCGCTAACA
AGTGTATCTCCTCCAAAAAGAAGCTGGACGCACAGTCCAGCCAAAACTAGCACGGAGCGGCGGGAGGCGGAAGGCGCCTTACAGGAAGGCGATATCTGTC
GGATGCTCATCGTGAGATGAGATGAGAACTGGGAGTCTTCAAGCCTGCGGCGGGGTCCGACCAACGTGGCATTTTACTCCGTCGGGATCTCTCTGCGCCC
CGCAGCATCGCGTGCTTCGCCACCAAGCCAGAAACGAAGAGCTCTTCAAATAGGTGCGTAAAACGCCTTGGTGCTCGCTCATTATTCAGGTTTCACTGAG
CGCCCTGCACTCCAAAATTACATATGTGTCAGCCAGCCAAGGCGATTCAGCTCGAAATTCGCCGTTCGTTTCGCCATTGGAGAGAGCTCTCCTCTTGTCA
CAAGGAACACGACTGGACAAGTAAAAGTGCGATGGTGGAAGCGTCCTCGCAGCTTCTCAGAGAAGGTTCTGCCCCCGCGAGCAACGCGAAGTGAGCGTTG
AGGCAGCAAACACGTCGCACCCCTGCAGTGAGAGACATCCTTTTGCCTTGAGGCAAGCCATCTAGTTGAATACTGAAGCATGTCAGTCAGTGCTCATGTG
GCGGCAAGTTGAGTCCGAATCCCCCACCATAGAATTTCTTACCGCTGCAAATCAATTCGAGAGTGCCATTATAACGCTGCTATCCAGCATCTTGGCAGCC
AATACACTCGGTAATCCTACGACAGGCCGCAGGTCAACGTTGTCAACGCCGTCGTCCTGCAAATTGTCGCCACGACCAAGAAGAATACCAAAGCAAAACA
GCGCACCCAGCCACTACCTGACGAAGTTGAAGTTCTCTTGAGCTCGTTCTGCCTTTTCCTCCAATCAGATCATCTTATCCAGGAATAAAAACGCACCTTC
CTCGATACAAAACCAACAAAAAGCCCCGCCCCGCCCCCTCCGCCCCCATGAGCGAGCGCGCGGCCGACGGCGCCTCCAAGCCGCCCAAAGAGCCCGCGGC
CCAGCTCAGCGTGGACGACGAGATCGCGACCGTCATGACCACGGCGTCCACCACCAAGAAGAAGGAGGACATGCGCAACGATAGCACGGGCATCACCGTG
GGGGACTCGGCCCACACGCTGTCGGACGTGCGTGCTGACGGCTTAAAAAATCGTCGCAGAAGAAGAACGAGGAGAACTGACTGTTTTTTTTAATTTTATT
TTACGATCTTTTCTTTCAGGGCAAAACGATCCACTACTCTGCAGAGCGGATCATCGGCAATGGCTCGTTCGGCGTCGTGTTCCAAGCTCAGTGGAAGAGA
CGGGCGAGATCGTCGCCATCAAGAAGGTGCTGCAAGACAAACGCTTCAAGGTGGGGGAACGTTTTGTTTTAAATATGTGCTTATTCTTCTACTGACGTTT
ATTTTAATTTATTATTGCTGTTGTTGTAAGAATCGGGAGCTGCAGATCATGCGCCAGCTGCACCACGTGAACATTGTGCAGCTCAAACACTGCTTCTACT
GCAACGGAGAGAAACCAGACGAACTGTATCTGAACTTGGTGCTCGAGTACATCCCCGACACGGTCTACGGCGTCGCCAGGCAGCTTCAGAAGGCCAAGCA
GTACATGCCCGTGGTACTGGTCAAGCTCTACATCTACCAGATTTGTCGCTCGCTGGCGTACATCCACTCCACGGGCATCTGCCATCGCGACATTAAGCCG
CAGAACCTGCTGCTGGATCCCAGGTCTCACGTGGTAAAGCTGTGCGATTTTGGAAGTGCCAAGGTGCTGCAGAAGAATGAGCCCAATGTGTCGTACATTT
GCTCGCGCTACTACCGAGCCCCAGAGCTCATTTTCGGCGCCACGGATTACACCACAGCTATCGGTAATTATTGCAGTTCTGTAGCTTAAAAGTGGTTCGT
GTGCTG