Description :
From Genome Similarity Track
Location :
Scaffold_5:103160- 107952
Sequence
4792 bases(100 bases per row)
GAGGGAAAAGAAGGGAAGAATCTCCTCCTGTGGATCAGAGAGGTGGAAATGGCTATGAACTCTGCTATGCTCCAGCTGAAGCAACAGCGAGTTGGGATGG
CTATCTCAAAAATGGGTGGTCGATCCATAGAATGGGCTCTCACGTGTAACACGTCGGTAGACGAAGCTTTTCCCACATGGGGTTTGCCAAAACAGCAAAT
ATCCCGGGTGTTTGCTCCGCCTAATCAGGCATACCGGGTGCGTTCTCGTTTCTTATCTACTCGTCAGGGCAAGAAAGAACTATCGAACTATGTCCAGGAA
CTGAGAACTCTAATCGCTTCCACGCAGCTTGATCCCTTACCAGAAATGGCTTTGGTTACCATCTTCATGGAGGGCCTTCGCACGAGCGTGGCTCGAACGG
AAGTATTCCGGGTACACCCCACCTTCTTTGAGGCGGCTGTGGATATCGCGTTGAACGCTGAGTTCAACTTTAAGGCAGCCCGTTTTGGCGCCCATGGGTA
CAATCCAAACTCGGTGAACTCCTGTAGTTCATTCAATAGACCGTAGCCTATGGACCTCAGTCTCGCCAAGACGGACGAAGAAGCAGAGCTTCGAGCTGTA
GAACAGCATCGAAACATTCGACGATATTTCACGTGCGGAAGCACAAAGCACCTACGACCTAATTCCCCTTCACGCAGGGCACGCCAGGCTACTTCAGGCC
GAACCCCCGCCGCTAACCAGAACTCTGGTACGGTGCGGGAAAACGTAGACTCCCAGTAGGCGCGGGGCGCCCTGCTGGGGAGGAAAACAAAATAGGTTCT
GTTCAGCCTCTAGAAGGTATTGTCGAGCAGAATTTAGCACCAAGGATTCCCGTGTACTCTAACACGGGGCGTGAATACAAGACAGGCTTGTTGGTCACAA
AGGCGACTGTTAAGGGCTTTGACAAACCCTGATTGATTTTGATCGACTCCGGATCATCCGGCATTTATGTCAGACGCTGTTCTCTTGAAGGGAATCCACG
TTATGTTGGGGCGCTAGAAGCACACGGGGGTGATACGATCACTGTTTGCTTGGCGACAGGAACTCTAGTCACTGCACTAAAAGTTCCTGTGAGCTTGGGT
GTGAAGTTTTTCGATTTTGATAGTATCGAACGCTGTTTAGTCCCTGATTTGGACTCGAGGTGTATGATCTCATTCTTTGTATGGCTTGGCTTGAGCGCCA
TAAGGCATGGATAGACTGGAGGTCGAAAACATTAGACATCACGCGCACCCACCTCTGCTAGGAATCAGAAGCGCTATTGGCGCGAGACAGTGGCTGAAAA
TGTCAGTGTACTGGACATTGGAATGTCACAGTTAGTTAATTCTGACAATGTCAAAGACATGGGTATAGAGAAAAGTTTGATATGTGATAGTGAATCGGCA
CGTAATCCGCTAAGTGATAGTCGTTGCGGGAGCAACGTACTGAATGCTGAAAGCATTGTTGACCAAGCGTCAAGTCATCGAGGGTTGAACCCATCATATG
AGCGTGGAGTGGTACGTAAGTACCCACTGAGTGATGTTGGCTGTGATAGCGACGCGCTGAATGTCAATATTGACGTTGTTGCTGAAATATCAAGGCATCT
CGAGCCACGCTCAGCGGATGCACGTGAAGTGGCACGTAGTCCACGTGATGACGACGTCATGTACAATGACTCGTCATCGGATGTCAATAGTGACGTCAGC
TCTGGTTTAGAGCAAATTACGTTCGATGATGGTATCGATCAGAGAGATATGAATTCCACATCGTGTGCTGTGTCACAAAGTGATGATGACTGTCAGCTGT
ATACACTCGTCAACGGAGTGACTGGTGCCTGTGATGGTACAATTAGCCTTGAGGCTATACCCTCATCAAGTTCGCTTTTAACTCGAAGAATTCAGTCATT
CGGGTCAGTCGATGAGTTTGCCACTCACTAAAGAATCGAGACCTTTCAGAGGTGGTGGTCATTCGACCCGACATCATAGAGTTGAACCCTTCTTCACTTT
TGGATGAAGACGTCCTGGAGGACACAAAAGCATCATTTAGTGCGCGTAGTGTGTCATCAATATTGAAAGACCCTCATGATCCTTTTTATTCCTTAGTCAA
GGAATTTCAAGATGTGGTGTGCCACGATCCACCCTCTGTTCTACCTCCAGATAGAGGTGTCCGTCATGAAAAATTGACTTAGTTCCTGGGACTAATAGTA
TGTCACAAGACAGTGGTCCTTGCCCAAGGAGCAATGTGATGTCATTGATGACTTTTTCCGTGCTAAGCGCGAGGCAGGAATGGTACGTGAGAGTAAATCT
ACACATATGACACCGACATTTTGTGTCAAAAAGCTGAACGCCAAGTGGCGTATTGTGAATGCTTATAACAAGCTTAGTGCGGCTACGATTCCGGCACAGA
CACCCATTCCTCAAAAGGATGTTCTTCAAAACAACATGGTTGGTTGTACTATGTATAGCGCAATCGACTTGGTCGACGGATATTATAAATTGCTCATGCG
AGCGATTGATATTACGATTACAGCAGTGAGCAAACCGATTGGTATGCTATGGGAATGGCTGGTGATACCCCAAGGGCTGTCTGATGCTCCGGCAACATTT
AACCGTCTGTGACGCAACGTTTCCGCCCACATCGGGATTACTCCCAGACGTACTTTGATGAAATTTTTGTCCATAGTCGTGCCGAACAAGGTCGGTCAGA
AGCTGACAACAACATCGATCATTTGCGAGCCGTGCTCGAGTGCATGCGCACTAACAAATTTTACGCCAACGCGTCTAAATGCATTTTTGGTGCAGAGTAG
ATCCCATGTTGGGGCTGTTTCATTGATAAGCGCGGCTTTAGAGCGGATTCCGCTAATGTCAAGGCTATAGTGGGCTGGCCGATTCCTAAGAATCAAAAAG
ACTTGCGTAAGTGGCTTGGCCTTGCCAATTACTTACACAAATACAGTGAAAATCATGCTGATATGACTCGGCCATTAACTGATCTCCTTAAGAAGGACAC
AAATTGTCGCTGGGACAACACCGATGCTTACGCATTTCGGGCAGTAAAGGGGAGTCTCCTCCATGCTCCTATTATTGCGTTGCCAAATCCTGAGTACCCT
TTTAGTGTTGTCTGCGATGCACCAAATTTTTCTATAGGCAGCGCCCTGTCACAAACAGATGCTGCAGGCTGCGAGCGAGTTATCGCATTTGAATCTCGTC
AGCTGAAAGCTGCTGAAAAGAACTATCCCGTTCATGACAAAGCGATACTTGCTATGAAGTATGCGCTCGTCAAATTTAGAGTCCATCTGCTTGGCTCCAA
GCCATTCGTCGTCTTTACGGATCATGCGTGATTGCGCACGGCGACACAGTCGCCTCACCTCTCTCAGAGAATGGCTCGGTGGCTTTCCTTCTTTGCGGAA
TATAACTTCGAGGTGAAGTATAAGCCAGGCAACAGAATGTGTTGGCAGATGCCCTCTCTCGCAGACCTGATTATGAGCTTGCTCATGTCACGACTTTGTC
GCCTCCTATTGAGGAGTTAATTCGTGTGGCATATCCACGGGATTTTCAATGTGTGGCATTGTTTCATGCCCTTGGAAATGAGGGATACAAGGACTTGGAC
AGTCAATTATTGGCACGCTTGTGGGACAGCCTACATCGATAATGATCTCTTGTGCTATGGCACAGATGTAGCGGATACCGCTAGCATTGTTGTACCTCAT
GATGAGGATTTAAAGCATCAAATCCTCTTTGAGTCCCACGATACTGCCCTCGGTGGGCATTTGGGCCAGGAAAAGACTTCTGGCTCTGTGGCTCAACACT
ACTGGTGGCCCAAACTCTACAAATGGGTGAGCACATACGTGCATACATGCGAAACGTGCCAGCGGGTCAAACCCTCAGCACATTCGGCTGCGCCACTCGC
CAGTTTACCTGTTCCCACGGGGTGTTGGGAGTCCATCAGTATGGCTTTTGTGCTCGGTCTTCCCAAATACTGTGACGGAAATACGGGTATTGTGGTCTTT
GTTGACTGTCTAAGCAAGATGGCTCACTTGGCGGCGGTGCCGGATTCCATCGATGGCAAACGTTCAGCTATGCTGTTTATCGATCGTGTGTTTCGTCAAC
AAATGTTGCCGCTGTCAATCATCTCTGATTGCGACCCTCGCTTCACAGGCAAGTTTTGGACTTGCCTGTGAAGCTGCTTGGCACGCGATTGGACATGTCC
ACAGCGATGGTCAGACTGAGCGAGTTAGTCGCGTCATTGGCGACGTTCTTCGCAGTTTTTGTGCTGAGTCGCCTAAGACTTGGAGCTCGATGCTCCCTGT
CATTGATTTTGCGTTGAACGACGTTGTTCATGCCTCGACCGACTTTACTCCCTTCTATGTGAATAGCCTCACGCACCCTGCGTTCCACTCACGTTACCAC
TACGTGATTCTGGGCTTGGTGGGGGAGAGTCTGCTGACAAGCTTGCTGACATCAGCCCTACCACGATGCAGAAACAAGTGAGCGAGTTTCTCGCGACGCG
CTTTGGTGTCTTACGACAAGTGCGTGATGCAATGGCTGATAGCCAAGATAAACAAAAAAAACTAGCTGATGCTAAATGCAGAGGATATATTGATTCTTAT
GAAGTTGGAGACCAAGTCTTATTAAATGCTAAAACCTACCTACAAATGTAGTGTCTGCCGTCTTCAAGACGAAATTGCGTCCGTGCTTCATTGGGCCGTT
TACGGTCATCGCGAAGAAAGGCCTTGCCTGTACACTCAATCTCCCGCGCATACTGCGCACAGATCCAGTGTTTTACGTTGGCTTGCTTAAGC