Description :
From Genome Similarity Track
Location :
Scaffold_337:10316- 13435
Sequence
3119 bases(100 bases per row)
GGGGGGAGGGGGGATCGCACCGTCGATCTCCGCCGTGAAAGTGGCTTCGAGTCGCCTGACCAGGTCAGCGGTGTCGATCTGCCCGCCTACACGCGTTACG
ACGCCGGCGAGACGATCGGCAAGCTCGTCGCGCACCCGCCGCGCCAGCTCTCGGCCCCGACGCGCGTCTCGAAGCATCCGACGCCAAGCCACAGCGCGTT
CGTCGCGCTCTCGGATGGCCAAGTCGCGCTCCTCCTGCAGCTCGGCGACGCGAGCGCTGAGACGATGGGTCTGGGCGCCGACTGCTCCTCGACGCTGCTG
CGACGACCGCTGCATGGACAGCCACCCAGCTCGATACTGCGCCGTGCGAGATGTGGTGCAAAGTTCGCCGGCTTGAGCCCGCGCCATCTCGGACTCGGCG
GCCACACGGAGAGTCGTAGCAGTAGCCACTGACTCCTCCAGCTCGTGGATACGCGTCGCGCCGCGGCGGAGCTCCTCGGCGTGGGCCACTAAGAGCGCGT
TGACGCGCCGAAGGTCGTCCTGCAGCGGGACGTTCAGGTTCGGGGCCGCCTCGATCTCCATGCGGCTATGAGAAAGCGACGCACGGGCCGCGCGGAGATC
TTCGTCGACATGGGCGCGCTGCTGCTCCAGAGCGGTCAAGGCCTGACGAGCCTGATCTCTCTCGGCGACGGCAGCGTCTCGCCGCTGCTCAAGGGCGGCC
ACGGCTTGACGTGCCCGGTCCCTCTTGGTGACAGCAGCGTCTCGCTCGCGTCTCAGGGCCGTGGAGGCGCGACACACTTGATCTCGCATGTCGAGGGCCC
CGTCACGCTCTTGCTCGACGACCATGAGAACGCGGGTCACGCGGACACGCTCGGCGAGAGCGGCGTCGCGCTGCTGCTCGGCAGTGGCCACGAGCTGCCG
CATGTGATCTCGTTCAGCTTCGGCGGCGGCCACGCGCGCTTGGACAGGAGCGAGGGCGGCTTGGGCGGCTGCGAGGTCGACGCGAAGGTCGTCACGCTCG
GCGCGCGCGTCGTCGCGCTCGCCTTGTGCAGCAAACAGCTGCGCTAGCGACACGATGGAGGGAGGCGGCGTAGCAGGAGCGCGCGCGAGTTGGGCAGTCA
AGTCAGTGACCTGGTCTCGTGCCGCCCGGAGCTGAGCTTGAAGATCACGATATTGCTCTGTCGAGGAGCCTCGCTCGGCGCGGAGTAGAGCCTCGGCAGC
GTCGGCACGCTCAGCACGAGCGCGGAAGTCGGCCACTCGGTCCTCCAGGACGGCGTAGTCCCGCTCGGCGTGCTCCCGGGAGAGGAGCGCCTGCTCGAGC
CGGATCATGCCTGCGCGATAACCCTCGCGAGCACGATGCAAGATCGCGAGATTGCGGTCATGCAGCACGGACGCGTGAGTAGCCAAGCCCGCATTGTGCG
CTGAGACGAGTTAGTACTGGGCGCGCAGCTCCTGGTTCTCGCGCTGGAGAGTGTGCGCGTCGGCGACAAGAGCAGTCACCGAGTGGACGGGGGCGCCTGA
AGCCGGAAGCTGGACTTGGGGCGCGACGGGGAGGCGAGGACGATGCGCGCCGAGGGCACAAACCGCGCAGCCAGCGGCCTCGAGGTCGTCGGTGTCAAGC
TCTTCTTCCTCCAGGTCGATGTCGTTGACGTCGACGTCGTGGCGGCGAGCCATGAAGCTTGGAGTACCGCGAAGCGGACTGCGATGGCAGAAAACGCGAT
GGTGTCGAGACGAAGCGAAGGCGCGGGGCAGGTTCTGCGACGACACACCCACCTGGGGAGTGCGCGGGCGTGGCAGCGGGACGAATGTGGTGTAGTACCC
CGCGGAAGAAGTGGGCGCGCCGGGCGCCGGAGGAAGAAGGCGCCGGGACGCGAGTGATGGACCTCGACGCGGCTGATGGAACGTGACGCGGATTGATGGG
CGCGACGCAGGGCTGAGCTCGACGGGAAAGTCGGCGTGGGTGATGGGCCGTGAGACACGGTACCAGAATCCAGTGCGACGCGTAATCATCCGACGGGTCG
ACCAGCGCACCCGGTTCTGCAAAACGCGCCGACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCCAGGGGAACCACCAAGCGCCGGCAAGTAGAGCCGCCTCGATATCG
CGGCCCCCCGTCGTTTGCTGGTTCGGGTGCTCACCCCCCACAGACCCGTGCTGGAACAAAGGCACGTTAAACGTATACCATTTAGGTGGGCGCCCGATAA
CGCGCTGCCTAGGCGAAGGACCGCACTGGCCTGATAACCGCCGTGCACAAGACCCCCCGTGTAGGCCCGATAACGCCACACAAGCCCCAGGAAACGCCGG
CCTGATACCGCCGCACGCCCGACGGGAACGCCGAGGAAACGCCGGCCCGATAACGCCGCACGCCCAAGGCTCGACGCCCTACGACAAGGAACAAGCGTCA
ACACAAGAACCCCCCAACTCTGAAGCCTGCGAAGACTTGGGCCTGTATTTCGAAGATACGCTACTCCAACAACCGGGAATAATTCGCTCGGCGCGACCGC
TATCCAGACGCGCCGAGTTTGTGCGAGATCGCATTCGCGAGATTTCTGCGAGGGCGATACTCGACACCGGCGTCCATACGCCCAACTTCTTGCACGTCCG
CCAAGACAGGACATGGCGAGCGCGACATTCGACAACGGGTCGACAATACGTCGAGCCGCAATGGCAGTGTCGAGTTCAACAAGCCAACGGAGGAGAGGTT
CACCCTCTCTTCCGACATAGTTACTCACATTGAGCTTCAGCGATTGCGCGCGTGGTGTTGTGGTGTAGCGGGATCGGCCGAAATCTGGTTAAGGCCTGAT
CGAGCTTCCCACCAGCGCCCAGACACCGACTAACGGAGGGGGCCCCCCAACGATCCGTGATCGGCTGAACTTGCTCTCACCTTGTGTACCCGTCGGCGAA
CTGGATCCGCTCTCTCGGGGCTCCGAAGATGCAGCACTTGGTGAAGATCGAGTGTCTTGGCGTGACGCGGGGATAGGTTGTGGAGCAGCGCGGTAGTCTT
CGCTCTGCGTCCGAGTATA