Description :
From Genome Similarity Track
Location :
contig_46:103159- 105083
Transcript NameFunction/comments
g9582.t1RAW34530.1 hypothetical protein PC110_g9158 [Phytophthora cactorum
g9583.t1hypothetical protein

Sequence
1924 bases(100 bases per row)
CATTGTGTCCAAATGGCGGGGCTTGCAGAACGTCGCCTGCTCGGTGGTTGCGTTGACGAGCAGTGTCGGGGGCGAGAACTTGCCGTTGGGGTCCCATGAG
TCATTCTGCGCGCTAACAAGTGTATCTCCTCCAAAAAGAAGCTGGACGCACAGTCCAGCCAAAACTAGCACGGAGCGGCGGGAGGCGGAAGGCGCCTTAC
AGGAAGGCGATATCTGTCGGATGCTCATCGTGAGATGAGATGAGAACTGGGAGTCTTCAAGCCTGCGGCGGGGTCCGACCAACGTGGCATTTTACTCCGT
CGGGATCTCTCTGCGCCCCGCAGCATCGCGTGCTTCGCCACCAAGCCAGAAACGAAGAGCTCTTCAAATAGGTGCGTAAAACGCCTTGGTGCTCGCTCAT
TATTCAGGTTTCACCAGGCGCCCTGCACTCCAAAATTACATATGTGTCGGCCAGCCAAGGCGATTCAGCTCGAAATTCGCCGTTCGTTTCGCCATTGGAG
AGAGCTCTCCTCTTGTCACAAGGAACACGACTGGACAAGTAAAAGTGCGATGGTGGAAGCGTCCTCGCAGCTTCTCAGAGAAGGTTCTGCCCCCGCGAGC
AACGCGAAGTGAGCGTTGAGGCAGCAAACACGTCGCACCCCTGCAGTGAGAGACATCCTTTTGCCTTGAGGCAAGCCATCTAGTTGAATACTGAAGCATG
TCAGTCAGTGCTCATGTGGCGGCAAGTTGAGTCCGAATCCCCCACCATAGAATTTCTTACCGCTGCAAATCAATTCGAGAGTGCCATTATAACGCTGCTA
TCCAGCATCTTGGCAGCCAATACACTCGGTAATCCTACGACAGGCCGCAGGTCAACGTTGTCAACGCCGTCGTCCTGCAAATTGTCGCCACGACCAAGAA
GAATATCAAAGTAAAACAGCGCACCCAGCCACTACCTGACGAAGTTGAAGTTCTCTTGAGCTCGTTCTGCCTTTTCCTCCAATCAGATCATCTTATCCAG
GAATAAAAACGCACCTTCCTCGATACAAAACCAACAAAAAGCCCCGCCCCGCCCCCTCCGCCCCCATGAGCGAGCGCGCGGCCGACGGCGCCTCCAAGCC
GCCCAAAGAGCCCGCGGCCCAGCTCAGCGTGGACGACGAGATCGCGACCGTCATGACCACGGCGTCCACCACCAAGAAGAAGGAGGACATGCGCAACGAT
AGCACGGGCATCACCGTGGGGGACTCGGCCCACACGCTGTCGGACGTGCGTGCTGACGGCTTAAAAAATCGTCGCAGAAGAAGAACGAGGAGAACTGACT
GTTTTTTTTAATTTTATTTTACGATCTTTTCTTTCAGGGCAAAACGATCCACTACTCTGCAGAGCGGATCATCGGCAATGGCTCGTTCGGCGTCGTGTTC
CAAGCTCAGTGGAAGAGACGGGCGAGATCGTCGCCATCAAGAAGGTGCTGCAAGACAAACGCTTCAAGGTGGGGGAATGTTTTGTTTTAAATGTGTTCTT
ATTCTTCTACTGACGTTTATTTTAATTTATTATTGCTGTTGTTGTAAGAATCGGGAGCTGCAGATCATGCGCCAGCTGCACCACGTGAACATTGTGCAGC
TCAAACACTGCTTCTACTGCAACGGAGAGAAACCAGACGAACTGTATCTGAACTTGGTGCTCGAGTACATCCCCGACACGGTCTACGGCGTCGCCAGGCA
GCTTCAGAAGGCCAAGCAGTACATGCCCGTGGTACTGGTCAAGCTCTACATCTACCAGATTTGTCGCTCGCTGGCGTACATCCACTCCACGGGCATCTGC
CATCGCGACATTAAGCCGCAGAACCTGCTGCTGGATCCCAGGTCTCACGTGGTAAAGCTGTGCGATTTTGGAAGTGCCAAGGTGCTGCAGAAGAATGAGC
CCAATGTGTCGTACATTTGCTCGC