Description :
From Genome Similarity Track
Location :
Scaffold_96:103150- 104160
Sequence
1010 bases(100 bases per row)
TGCAAACGGAACCCCTCTGAGCCCTGCTTGATTCCTCAACGAGTACTGTGTTCACTCCCGACCGGAAAGAAGGGTTGCTCTGCTATAAGTTTCAGCCCGT
GCGGTCGGTATCTCGCTGCCAGTGTGAGCCCTGAACTGGGAGAATTTGTGGTTCGAGTGTATCAAATGGCATCTGGAGAGCTGTTTGCCGTCGGTCGAGG
CCATAGAGGAGTGATCTACTCCTTGGAGTGGACAAATACCTCGAACGGTCAGTCTCGACTGCTCTCAGCGTCATCGGATGGTACTGTTCGGCTATGGGAG
TTCCCATTGATGAATGCCTCCATTCCCCAGGCTTCTCCACCGGCTTCTGCCTCTCGATTGCTATCGCTGGTATTCCAGTGGCATCACTTTCCTTGCTTCG
TGTATTGCGCTATCTTTCTTCCAGGTAGCAATGGGGATATCGTCGTCACGGGCTCTTCGGATGGCTTCATGCGGTTCCGAAAGGAGTCATCGGTTCCAAA
TGGCCAACCTGAATACGGAACAGTTCGTGTCAGCTCTGTTGCAGTGCACAGCATCCGTGTAGACCCCAAGTCTGAGCGTGTTTTCTGTGGTGACGCAAAG
GGGGATATCACGGTGTGGGCCCGTGCGTCGAGTGCGTCGAGCATTTGCGACTATAAACTCATCAAGACGATTCGAACGGGGCAAAGCAACATCACGTCTC
TCCAACTGCATCCTCGAAAGGCTCACTTGCTCGTCCACACGCAACCAAACGCGATTTTCCAGTACGAGCTGCGATCCTATCTCTTGCTGAACAAAAGCTA
CGCCGGGGTGGCTTGTGAATCGCTGTTGGTGAAGAGCACGTTCAGCCCCGATGGCAAGCTCGTGATTAGTGGGTCTGAAGACGGCGTTCCTCGGCTCTTC
ACCAGTCTCCATGGCCAGCAACTGCAGCGCAGTGTGTGGGGTACCCACTTCTTTCACGGTGGTCCTGTGCTGGACGTGAGTTGGTCACCTACGGCTCACA
TGGCCGCACT