Description :
From Genome Similarity Track
Location :
contig_46:103146- 105071
Transcript NameFunction/comments
g10046.t1POM74311.1 Endo-1,3(4)-beta-glucanase [Phytophthora palmivora var. palmivora
g10047.t1hypothetical protein

Sequence
1925 bases(100 bases per row)
GGTTTGCTCCTCATTGTGTCCAAATGGCGGGGCTTGCAGAACGTCGCCTGCTCGGTGGTTGCGTTGACGAGCAGTGTCGGGGGCGAGAACTTGCCGTTGG
GGTCCCATGAGTCATTCTGCGCGCTAACAAGTGTATCTCCTCCAAAAAGAAGCTGGACGCACAGTCCAGCCAAAACTAGCACGGAGCGGCGGGAGGCGGA
AGGCGCCTTACAGGAAGGCGATATCTGTCGGATGCTCATCGTGAGATGAGATGAGAACTGGGAGTCTTCAAGCCTGCGGCGGGGTCCGACCAACGTGGCA
TTTTACTCCGTCGGGATCTCTCTGCGCCCCGCAGCATCGCGTGCTTCGCCACCAAGCCAGAAACGAAGAGCTCTTCAAATAGGTGCGTAAAACGCCTTGG
TGCTCGCTCATTATTCAGGTTTCACTGAGCGCCCTGCACTCCAAAATTACATATGTGTCAGCCAGCCAAGGCGATTCAGCTCGAAATTCGCCGTTCGTTT
CGCCATTGGAGAGAGCTCTCCTCTTGTCACAAGGAACACGACTGGACAAGTAAAAGTGCGATGGTGGAAGCGTCCTCGCAGCTTCTCAGAGAAGGTTCTG
CCCCCGCGAGCAACGCGAAGTGAGCGTTGAGGCAGCAAACACGTCGCACCCCTGCAGTGAGAGACATCCTTTTGCCTTGAGGCAAGCCATCTAGTTGAAT
ACTGAAGCATGTCAGTCAGTGCTCATGTGGCGGCAAGTTGAGTCCGAATCCCCCACCATAGAATTTCTTACCGCTGCAAATCAATTCGAGAGTGCCATTA
TAACGCTGCTATCCAGCATCTTGGCAGCCAATACACTCGGTAATCCTACGACAGGCCGCAGGTCAACGTTGTCAACGCCGTCGTCCTGCAAATTGTCGCC
ACGACCAAGAAGAATACCAAAGCAAAACAGCGCACCCAGCCACTACCTGACGAAGTTGAAGTTCTCTTGAGCTCGTTCTGCCTTTTCCTCCAATCAGATC
ATCTTATCCAGGAATAAAAACGCACCTTCCTCGATACAAAACCAACAAAAAGCCCCGCCCCGCCCCCTCCGCCCCCATGAGCGAGCGCGCGGCCGACGGC
GCCTCCAAGCCGCCCAAAGAGCCCGCGGCCCAGCTCAGCGTGGACGACGAGATCGCGACCGTCATGACCACGGCGTCCACCACCAAGAAGAAGGAGGACA
TGCGCAACGATAGCACGGGCATCACCGTGGGGGACTCGGCCCACACGCTGTCGGACGTGCGTGCTGACGGCTTAAAAAATCGTCGCAGAAGAAGAACGAG
GAGAACTGACTGTTTTTTTTAATTTTATTTTACGATCTTTTCTTTCAGGGCAAAACGATCCACTACTCTGCAGAGCGGATCATCGGCAATGGCTCGTTCG
GCGTCGTGTTCCAAGCTCAGTGGAAGAGACGGGCGAGATCGTCGCCATCAAGAAGGTGCTGCAAGACAAACGCTTCAAGGTGGGGGAACGTTTTGTTTTA
AATATGTGCTTATTCTTCTACTGACGTTTATTTTAATTTATTATTGCTGTTGTTGTAAGAATCGGGAGCTGCAGATCATGCGCCAGCTGCACCACGTGAA
CATTGTGCAGCTCAAACACTGCTTCTACTGCAACGGAGAGAAACCAGACGAACTGTATCTGAACTTGGTGCTCGAGTACATCCCCGACACGGTCTACGGC
GTCGCCAGGCAGCTTCAGAAGGCCAAGCAGTACATGCCCGTGGTACTGGTCAAGCTCTACATCTACCAGATTTGTCGCTCGCTGGCGTACATCCACTCCA
CGGGCATCTGCCATCGCGACATTAAGCCGCAGAACCTGCTGCTGGATCCCAGGTCTCACGTGGTAAAGCTGTGCGATTTTGGAAGTGCCAAGGTGCTGCA
GAAGAATGAGCCCAATGTGTCGTAC