Description :
From Genome Similarity Track
Location :
Scaffold_53:103127- 106406
Sequence
3279 bases(100 bases per row)
CAAAGATCTCTCTGTACACAGTATTGTTGGTGTGTACGTTCCCGTCCTTATCGATGGTCTCTGGATCCACAGCAATCTTGATCGCCTTCCTTGAAGTAGC
TCTCGACAAAGCCACATACAGCTGGCCATGTGCGAAGACCGGTAATTCCAAGTAGATACCCACGTGGTGGATCGATTGTCCTTGGGCCTTGTTGATAGTC
ATGGCAAACGCTGGAACCACAGGGAACTGCTTACGCTTGAGTTTGAACGGGAACTCCTTGTCATCGTCCTCACTATAAAAGACGATCCGAGGAATGAACA
TCTTCTTACCCTTGAACGGCCCGGACATAATGCTGGCCTCGATGCTTCTCTCGCGCAGTGACACAACCCGAAGCCGCGTTCCATTGCAAAGTCCTGCGTC
GCTATTCAGGTTTCTAATCATGATGATAGGTGTTCCAACCTTCAGAACAATCCTGTGCGGAGGGATACCGGAGAAGTTAAGAGAGTTCAAGAACTCCTGC
TCAAACATGTTTGCGTCCGCGACCCCTTCGAGGCTGTCCACCGAGAGATACTCCTTCGTTTCACCCGATAGCCGTTCCGCAACCATGTCGTTGATACGCC
GAACACTTGCATTTGTGGGGGCTAGTATGGCCCGCTCAACGAAGTAGTCATCGGGTAAATTCTCAGTATCAACGCCCGGGTACACCGCATCTATTAAGGC
GTTGACATTGCGGACTCGTCGGTCTTCTTCAACTTCGTCCAAGTCTCGCTCGTGTTCCTCGTCCGCCGGAGGTAGAAGCCTGAAACTTGGGGGAGGCTCC
ATATCCGCGTCTTCTTCATCAGAGGTAATTTGTTGTACCCGTCGTTCTGGGATGATACACATGTCGCGTGGAAGGCATATGTCGCCATCACCGATCTCAT
GGTTGACTGGATAACGGCCTTCTCCGATTTGAAGTAAAAATTCAGAGAACTCTGCTAGCTTAGCCGCACTGGCCGCGTCTGGGGCGGTGCGGACACGCAT
GTTCTCGGTCAGCCGCACTTGACGCCAATGCTCCCATAGCGGGGAAGACTTAAAGCAAGCTTGAATCGTCTCCGCACGCGTAGCATCCTTCAGTACAGGT
AGAATCTGGCGTTGATCACCGCTGAACACCATTACCTTTCCACCGAACGGCTCCAGCTCGTTCTTCATGATATCCCGAAGCGACCTGTCAACAGCCTCAA
AGCAAGCTCGGTTCATCATCGGCGCTTCGTCCCAAATGATCAAACTCGCGCTACGAATCAATTCGGCTTTTTGGCTCTGCCATGAAAGGCTGCACGTCGA
CGTCTCTGTTAGTTTGAGGGGAATCCGGAACGTTGAATGCGCGGTATGACCTCCAGTTAACAGAGTGGCCGCAATCCCACTCGATGCAACCGCGATGGCA
ACCTTACGTTGCATCCGAACGTGAGCGAGTATTTGCTCGAGTAGAAACGATTTTCCTGTTCCACCCGGACCATCCAAAAAGAAAAGCTTCTCCCCTCCAA
CCGGTCTGCTCACAGCAGCAATAACTTGGTCAAAAATATCCCTCTGGTTGCTGTTCAAGTGGTCTGCCTGCTCCGCAACATGCTCCAGTTCGTTTTGGGG
GTACGCGTCAATCTCTTGCTGGACAACATCAACAGACGCTGAATCCGGGTCGTCTACTTGAGCGGATACATCGTCGTAATCGGCTAGCAGAGGAAGGCCG
TACATGTCGAGGGACTTTTGGTTCGAAACCAAGTAATCAGCCAAATTCTTCAACGCCTTGTACTCCGCCATTCGAAGACGCACCTCCTCTTCGCGTACAT
TATGCAGGTCTGCGTCTCTTTCCTCAATGCTTCGTGCGTGATCCTCTGACATATCCTTCTTGAACCTATCCCATAGATCTTTGGCATTACCAGGCATCGA
GTAAACCAAAATGATGCCGAAGAGTTGGCGTAGCTGGTACGGCATCTTGACCTCGGCGGCTTCGCGTAAGCAATGTATCCACTCGTCGTCATTTTCCAAA
TACCCAAGCGCCAAAGCGGCTTGCTGATATGTAGGATGTTCCGTACCATCAACCGTTCGAAGATCCGCAAAGGACTTAGGCGAGCGTCGGTTACACAGGA
GAAGTCGCAAGTAGAAGCGTTCCGGGTCCTGCGGAGATACGTGTACCAAGCGTCCCAGAGAAGCAACGTACTTCTTGTACGGTTCCCACGTCTTGTGTTC
CGTCCACCTGTACTTCCGCGGTACATCCTTGTACAGTAGATTGACCGTAGTTTCTGGGTTACGCGCGCACAGCTTGAAAAACTCCGTCAGCATTGATCTG
TCCCCGCGGTTAATCAAGTTGTGAAGCTGGGGGGTCGTCGCTTGGTCGCGATAAGCAACCATGCTCATTATTTCCAAGTGGATAGGTAGCGTCACGACAG
AATGTGGTGATCCTTGTGTTGGATGCATGAATAGCCGCATGCAAGCTTCTACCGGAGAAATATACCTCCCACGGAGATACTGAAGAATTTCGTTCGCCCG
AATTTCTTCGCCTTCAATCGTGATTGTCGTCATGTCCGAGCCCTTGGAGACGTACTTGTAGATGTACTTGATGGCCTTGTTCGTGGCACAAACCTCGACG
TTAATGTGGCAGTTGTATTTCTGCGACAGAAACGGATTGTACGGGACCACCCATTGATTGATGGTCGCGTTGTCCCATACTTTCCCCTTATGGCACAGAA
TTCCATCCAGACGGCGACCACGCTTGTACGTGGGGTATCTGTCGGGGGTCATCATCGTTTCGTCCGCGAGCGCCTTTGGAAACTTCTTGGAACACCTTCC
GTTCTTCATACACGGGCAGTTCGGGTTCTGTTGACCACAGGGTCCATGCAGCATATTAGAAATCACCGTATCGTACAGCTCGGGGTACTTCTCTTTATCC
GGGAGCTCCGAGGACACCAGCTTATCGACGTCTTCCTTGGTAGTTGGCTTGTCCTCCGGACGCAGGATAAGGAGTATGTGGGCGTGGGGAAGGCCACGCT
TCTGGATTTCACTACATGGACTCGAGCGGCTTGAATCCCCAGCACACCCTCATCGAGATCCTTGTTAAGAGCTTTTAGTTTCTCCATGAACACGCGGGCC
ACGATGTCCGGTCGGTCGGATGCCTTTTCCCCACGGCGTAAGTTTTCCTTGATCTCAGGCCAGTTCGGGTTGCATGTCATCGTAATGAACAGGTTCGGGG
CTCCTGGCTCACGGACAATAGCCATGGCATCCAAGAAGCGTTGGTACATGTAGCGGGGACCACCTGTAAACTTCTGAGG