Description :
From Genome Similarity Track
Location :
Scaffold_238:10312- 11507
Transcript NameFunction/comments
Phymu_g7318alpha-ketoglutarate-dependent sulfonate dioxygenase, putative

Sequence
1195 bases(100 bases per row)
AAGTACGGGATTTCGCCGTGCGGCGTCACTCGGATCGCGTGGCGGTTGCCCGGCAAGTAGTCGAACGTGGCGTAGTGGAACGTGGAGCGGTTGTCCCAAA
TGGCCACCGCATTCTTCGTCCAGCTGAAACGCACCTGGAACTCGTGGCCTTCACTCACGTGCTGGTacagcagtcgcagcacGGCATCTGAAACATTCAA
AGCAATTAGCAGATAAATCTAAAAAAAATCTCCACTGAAATCCATTCCCCACCCGACTCCGCAGTAGATAGCTGCACAATACGCTTCGTGAACGCAGGGT
TCACATACAGAGTACGACGGCCGGTCACAGGGTGCGTGCGTACAACCGGGTGCTCAAATTCCACGGGCGGACGACGAATCACTTGTCCctttgcagcagc
agcagcagcttgaggctatcggacagcagcaacgaatTAGTTCGATacaataaaaataaaaactCTCCATATATCTCCAACGCCAACACTTACAATGCCC
GTGTGAATCGCCGTAAGACCGGAGATGAACTCCCTCATCGGAGGCGTAAGACGGTCGTACGCCTCGTAAGCAGAAGCCCACAATGTGTCACCGCCTACGG
GAGGGTTGGTCAATACCTTGAAGCTCGTGTACGAAGGCGGTTGACGCTCGTTGGACACGTCGCTGTGCCAGGCGTTGAACGGGTCGTACATCTGGCGCTT
GAGGAATCCCTCGCTCGTCTCGACCGAGTTCTCCACTATCAACACCTCGTGGTGGTCCTTCGGGTGGCCCAAGTTCTGGTGCACGTGGAGAGGTCCGTAG
TAGCGCCCgagctccagttgctgctccacgtTGATCTCCTGGtctcggaagaagacgacgccgcGGTGCGCGATCAGTAGAGCCAATTCGTCGCGCTGTT
CGTTCGTCAGCTCATGGAGTTGAATACCCGAGAGTTCCGTGCCGATCTTAGGGGCCAAATGCTTCACCGTCGCGCCCTTCAACAGGTTTTTGAACGTCGG
GTCGGCTTTGAGGCCTCGGTCCTCCACTGGGAGCACGGGGATCGGGTCGTACTTGGTTTCAGGGTACACGCTGAGCAGTTCCGGGTGCTCAAACGTGGCG
TGCTCCACCTCTTGGTTTAAAGCGTTCTTGACGGCTATAGGCTTAGCCTTGGTATCCGTCTTCGTGGTCGAGTCGTTCTGGTGTTGCGGAGCCAT