Description :
From Genome Similarity Track
Location :
scaffold_60:103119- 105394
Sequence
2275 bases(100 bases per row)
CAGATTTTTGTTGTGCTACATCGTGACTGGGAGACCTGCCTGCGCCGACTCGGCAAAGCAGACGATCCATCTTGTTCTTGTTTTTGAGGCAAAAGATGTC
CGCCATGAGGCAAGCTTAGCTTTGATGGGATGGGCCGGATCAACACGATTGTTGATGGGACACCAACAAAAGAAACATGGTGTTTCATGTAGATTTTCTT
GTCTCATTTTTGGTTGAAACGGAGGAAACGTCAAAGAGTTCTAGAACCGTTCTTTGCCGTTTAGGCGAGGAATGTTTTACTATTGTTGGTTCGCTAACTT
GATCGCATCATTGTTGCTCGAAAAGCTAGCTGCCCTAAAGGTCTGCGAAAGTATATATGAGATTACTGTTGACTTTCCGAGGGGATGATGTACTAGGTAA
GACTGACAACGTTCCCTCACGTTCGAGAAGGCCAACCAAAGTGCTGTTATGGTACTCTATAAAAGACGATGACGCAAATCTTCGTCATTTGAAACATCGA
ATCTCGCTGTATCCCTGCGTTCAACTGCATAGTACAACAATCCATTGTGTACTCCAAAACGGTGAACACGCGAACTTGTGCGAGACGGAAGATCTTGCAG
TGTTTTGTCGGAAGCGTCCTTGAATTACCCCAACAAgtcctgacatgtctcatcaAGCTTATACAATTTATTCGCGCACTATAATCGTTGCTTGCACTCT
GATTGTCTGAACATCTTTGCAATATCAACATGACTCGAGCATGATTTCGCTCCTGGACTTTGGATCATAATCCGGATgtcttgacaacgcatctgCTAAG
ATGTTCGTCTTGCCTGGCTTGAGTGACATCAAAGTTGTACTCCGCAAAGTAGGGAGCCACCGACCTTTTTCTGTGATAAATAAGGAGTCTTTACTGCCGT
ACGCTGtgaggcatgatctgtatagattgCGAAGCGTTTCACTACAAGCAAGTACACACGGAGCCTATCCAAAGCATACTTCACTGCtagaagctctttg
tcacGAACTGGACAGTTCCATTCCACGGGCTAGTGTTGTCGCGATTGATTCGAAACAACTCGCTCTCGGCCCTCATCGCAGTGTCGCGTCAATTTACAAC
CGATGGCATAATCACTTGCATCACAGAACCTATAAAAAGGCTCATCGTGGTTTGCAATTGCAAGGAGAAGAGCTTTTTTTCAAGCtcttcacttcggcaa
atatCGCCTGGTGACCATCTGACCATTCCGACGTTTTCTTAAGGAAGACAGTCAGGGGCGGCACCAGCGCTGCATAACTGCGCGTGTATGTGTGCAAATA
GTCGGCAAAGCCCAACCATTGTCTCAACTGTTTCACGTTGGCAGAAAATCATTGATGACTTTGACTCTCTCCGGATCTAGAGGAAAGACATTCATCCCCC
ATATAGCAGCCAAGAATGTGGATGTCAGGTgcaaaaaaagattttcaGGTTAGCTTTGAGTTCATTGTCCCGCATATCGTGGAAGACTTGACaaagatga
tcaagatgaacttCGACATCAGACTTCTCACTCGTTTTCTTACTATATACGAATAAATCGTCAAGTAGCTCGGTGCAAACTCTTTCAATGGATTGAGAAA
ATTCGTGACCATTCTGGTGAAAGTGGCGGGAGCGTTGTTCAAACCTTGTTNNNNNNNNNNTCCCTCATATACTGGAGGATCCTTCTTCTTGTGCTCGACT
CTTGATGCAACGAGAAATTCAAACCGTTTATTGGCTTGTTGCATCTGGGCTTGCATCTGAGCTTGCATCTGAGCTTGATATTGCTGCNNNNNNNNNNCAc
cgtacgccaatgcagacaaatgcatctttggcgcagaagagattcccttttttagggtgcttcattgggaagcgaggccttcgagcggatcccgctaatg
tcaaggccattgtagactggccgatcccaaagaaccagaaagatttgcgtaagtggcttggtctcgccaacttcttgcacaagtacagcgtaatcTACGC
AGAAATAgtccggccattatccaatctccttaaaaaggatgcgaaatggtgttggaacaccgaacatcaggaagcttttgacggggtcaaaaacTGCCTc
atgcatgcaccaatactggtgctACCAGACcgtgatcgtcctttcagcgtcgtctgtgacgcttcgagctttgccatcggctgcgcactgctgcaagcag
acgccgaggggcgagatcgggtgattgcgATCGATAAAGTTGCAGAGAAGCGATCGATATcgttgcagagaagaa