Description :
From Genome Similarity Track
Location :
Scaffold_573:10311- 12052
Sequence
1741 bases(100 bases per row)
GCAACGCGTGGGCGGCCGTCACGAACTTTTTTTCTTCCTGCTGGAGCTGCTCGCGCACGTGCTGCCGTTGCACGTGGGGCAGCAAGAAGGACGCCACGAG
GTCCTTGACGACCAACTCGTCGCTGTTGCCGCTCGCCTCGAGCGCCGTGACCATCGGACCCAGTGCGTCCGTAATCACGTGGAGCTCCTGGAGCGCTGTC
GACTGGGCCTGCTCGCTAATGACGTCGCCGACGAGATCGTCGATGAAATCCCTCGCTGTCTCTTGGTGCACGCGTTCGATACGGCGAAAGACCTCGTCCT
CGCGGTCGCGCAGTAGCTCTTCGGCCTGGCGACGACCACCTTCTTCGACTTCTCGGCGGCGGCGCCGCTCAAACGCCGCGTCGACAAACGCTCGCTGCTT
GGCGATCTCTTTGGACCGGTCGAGCTCTTTGTACAGCACATCGAGCATCTCCGAGATTATCTCGCCCTCGGCCTTGTGCATGGTCGCGCGCGCCACGCGG
GACTCGTCGTCGTCCATCTCGACCGCACCCCTCGCGCCCATGGCCGCGGCCGCCTCGTCGCTTGCGCGCAGCTCAGCGATGAGCTCCACGCGCCGCTCCT
TGCCTTCAAACATCATGTTTTGCACGGCGCGGCCGCGCACGAGTTTCTGGAGAAGCCGCACGGCGTCCTCTCGGTGTTCGTCCACGGCCGCGGCCCCGTG
CAGGGCATAGTCGGGCGTCGGCGGCCGCGTGAGCAGCAGTTGCTGCTGCTGCTGCTGCTGNNNNNNNNNNNNNNNNNNCTGCGCATCGTGGTCGGGGAGG
CCGCGTCGTCGGGGGTCTCATTAGCCTTTTTGATCATCGACTCCATCTTGAGCAAGTGCGCCTCGATCGCCGCCTGCTTCCGGTCTTTCGCAGTCACGAC
GGACGTGGCGTTTGTCTTGTGCTTCACCGGCGCCGCATGCAACATCCTGGACGGCACTGCACTTTCCAGTTCACAGAGCGTCTCGAGCTGCTGGAACGCC
GGCTGGGCGATGCCCACTTCACGGATCAGCGTCTTGCCCGACGCGCCACCGCGCGCCGCGGGCGCGTACACGGTCGACGCAAAGTCGGCGTACTCGCCAA
TGATGTCGCGCTTCAGCGCACGTGTCGGCGACGCGTGTTGCCGCTTCTTGGTGAGCTTACGCAACGCGCTCACGCGGTCCTGCTGGATTTTCTCGACGGC
GTTTTCCTTTTCGTGCTGCAGTCGCTGCCGCAGCGCCTCGATGCGCTGCTCGGCGAGGAAGGCGTTCTCCTTGTCGCGCGCCTCGAGCGCCTGCGCNNNN
NNNNNNGCGCGCACTCGGTTTGCCAACTACATTGAGATGGATCGCAAGCGGCTCGAGCGCATGGGCTTGGACTGGTCCGTCCTGGACGACACGCAGTCTG
AATAGAAGTGGGCAAGGACTAGTTCGGGTCATGTTCTCCACGTTCTCCGGGAAACCTACTGTTCTATGGTAATTCGACGATACTTGAACCCATCTGGTAT
ACACANNNNNNNNNNCCTCGAAGGCCTTCTTCAGTCGGGTCCGCTCGATGAGCTCGATCTCGGGCTTGCCCGCCGGGAGCTGTCCGTCGCGCTGGCGCAG
GTGGAGTAGCGACAAGAGCTCGGGCTCGACCACATCGCGCTGGCCCGTGAGGCTCTTCTTGACCGTGTAATCGGGCGTGTACGCGTCGGTCTGGGCCTCC
GAGTCGCGATACATGGTCTGCACGCCCACGGNNNNNNNNNN