Description :
From Genome Similarity Track
Location :
Scaffold_4:1031085- 1036709
Transcript NameFunction/comments
Physo_128406reverse transcriptase
Physo_128407hypothetical protein

Sequence
5624 bases(100 bases per row)
CTTCCTCTGACGCAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCTGACACCTGAGTCTGTATAGACTGACCCTCTGTGGAGAATG
GAGCAGTTCGCTCACTTGCCCCCGAACCAGCAGGATGCGCTTAAAAAGTTTATGTCCATGCTGGGCCCGGAGGGCGTGACGCAACTTGCGCAGCAAGGCC
CCGACGCGGTGAAGGCGCGTCTCGAGGCTTTTTCAAGCTACGAGAATGCTCTGCTAGAGCGCCTCCAGCAGAGGATGGCGACTGCCGCGGCGCCCCGAGC
GCCCCCTTTGTCGTCCGACGCGGGAACAAGACCTAAGCCGCTCATGTTGAGCGTGAAGACCTTCGAAGGCAAGGAGGGTGAAAGCTTGATGCTTTGGACC
CGTGAGGTTGAGATGGCTATGAGCTCAGCTCTACTCCGGACGGAGTCGCAGCGCGTGCCACTAGCTATCTCGAAGCTCGGTGGGCGAGCGAGAGAGTGGG
CACTAACGTCCGGGACGTCGGTCGAGGTGGCCTTCCCGACGTGGGACCAGCTGAAACAGCAATTGTCCCGAGTGTTTGCTCCGCCTAACGAGGCGTATCG
CGTGCGCTCACGCTTCCTGGCGACCAGTCAGAGCAAGAAGGAGTTGATGGACTACGTCCAAGAGTTGAGAACTCTCATTGCTGGCATGTCTGCGGACCCC
CTGGCGGAAGCAGTCACCGTTACGGTGTTCATGGAAGGCCTCCGCACTGGCGTTCCCAGGACGGAGGTGTTTCGAACCCACCCGAGCTCTTTTGAAGAGG
CTGTGAGCGTCGCATTGAATGCGGAACACAACTTTAAGTCGTCGAGACTTGGGTGGAATGCGTCTTACGCTAGCGGGTCGAGTGGTCCGGAACCCATGGA
CCTCAGCTATGCTGAAGACGAAGAAGCCGAGCTTCGTGCTGCTGAGCAGCGTCGCGGTATCCGCAGATGCTTCATCTGTGGTGACACCCGTCACCTTCGT
GCTGGGTGTCCGCTGCGCCATCAGCGCCAGGCTTCGTCAAGCCGCTCTTCGAGTTCGAGCCAGGGCTCTGGTTTGTCTCGGGGAAACGAGAAGTCCCAGT
AGGCGCGGGGCGGCCTACTGGGGAAGAACTAAGTTCTATTGAGCCTCGGCGAGGTGGAGGTCGACAGGACTTAGCCCCGAAGAGAGCCGTACTCTCTAAC
ACGGAACGTGTATGCAAGCCGGGCTTGCTAGTTGTCCAAGCTTGGGTGAAGGGCTTCACGAAGCCATGGACGATTTTGATCGATTCGGGAGCGTCGGGTA
ACTACGCCCGGCGTTCTACGATGGACGGAAGTCAGCTTTATGCTGAGGCGCTGGTAGCGCGCGGGAGTGACATCGTCACTGTTCGTCTCGCGACGGGCAC
TCGTGTCACGGTGCCTAAGGTCCCTGTGGACCTGGGCGTGAAGTTTTTGGATTTTGATAGCGTGGAACGCTGTCTGGTCTTAGACCTCGATTCGAGATAT
GATCTCATCCTTTGTATGACGTGGCTGGAACGCCACGAGCCTTGAATAGATTGGAGGTCGAAGACCCTTGGTGCTACGCACTTCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCGGATGAAGATCGTGGAGTGGCGCGTAATCCACTGAGTGGAGGCTGCGGATCGTGCAGCTCTTC
GCTGAGTGTCGGTAAAGACACTGGAGCTCCCCTGGAGCTGAACGAGGTGGTGACACCTGGCGTCAAGACGCACGCGAAATCACGGAGCTCTTCAGGGCGG
ACGGTGTCCATGAAGAGGAGGCAGCGCCGCAAAGCGCTGGCTGTGAGACGCAAGGCGTCTGCGATCTCACGAGTCGAGAAGGGCGTGTCGAGCGGTGAGG
CTCCACGCGAGAGCGAGCAGCTCTATACACTCGTGAATGGAGTGACGGGCGACGTCGACGGAGGTATCAACCTCGACGATTTGCCCTCACTGTCTGCTCT
CCTGGAGCTGGACGAGATGTCCTTGGCCGAGTTCGGCGAAGCCTTGAAGGCTGGAGACTTGGCCGAGGTAGTGGTCATACGACCCGAAGAAGAGTTGAAC
TCGTCCTCGCTTCTGGATGAAGCTGTCCTGGAAGACACCAAGAAGGCGCTGAATGCGCGGAGCGGATCGGCGATCCTGAAGGACCCGTCGGATCCCTTGT
ATCAAGTGGTAAAGGATTACCAGGACGTGGTCTCGAAGGAGCCGCCCTCGGGGCTACCTCCGGATCGAGGTGTTCGACACGAAATCGATCTCGTTCCGGG
AATGAAGTACTGCGTGACGAGGCAGTGGCCCTTGCCGAAGGAGCAGTGTGACGTCATTGACGCGTTCTTCCGTGCGAAGCACGAGGCGGGCATGGTGCGT
GAGAGTAAGGCTCCACACTCTACGCCGACGTTCTGTGTCAGAAAGCCGAATGGCAAGTGGCGTATCGTGCATGCTTTCAACAAGCTGAATGCCGCTACCA
TTCCGGCGCATACGCCGATTCCTCGGAAGGATGTTCTCCAGAACAACATGACAGGATGTACGATGTACAGTGCGCTCGACTTGTCGATGGATATTACCAA
TTGCTCATGAGGACGAGCGACATTCCTCTCACTGCGGTGAGTACTCCGAGCGGCATGCTCTGGGAGTGGTTGGTGATGCCCCAAGGCTTTCGAGCGCACC
AGCGACGTTTAATCATCTTGTGACGCAGCTCTTGAGGCCCCATCGGGCGTACGCGCAAACGTACATCGATGACATCTTTGTCCACAGTCGTGCGGAGCAC
GGAAAGACTGATATGGAGAACCATGTGGAGCACCTGCGTGCTGTGCTCGAATGCATGCGTCAAAACAAGTTGTACGCCAACATTGACAAATGCATCTTCG
GAGCGGAAGAGATCCCCTTCTTAGGGTGCTTCATCGGGAAGCGTGGCCTGAGGGCTGACCCGGTCAAGGTCAAGGCCATTGTTGACTGGCCGGTTCCCAA
GACCCAGAAGGATCTTCGCAAGTGGCTTGGCTTGGCCAATTACTTGCACAAGTACAGCGAGAACTACGCTGAGATGGCTCGGCCACTCTCCAATCTCCTG
AAGAAGGATGCGGAGTGGCGTTGGGACACCGAGCATCAAGATGCGTTTGCGGCAATTAAGGACAGTCTCCTTCATGCGCCTATTCTGGCTTTGCCAGACC
CCGCTCGTCCGTTTAGTGTCGTCTGTGACGCCTCGGACTTTGCCATTGGCTGTGCCCTGCTGCAAGCAGACGCCGAGGGGCGCGAGCGCGTGGTGGCGTT
CGAATCTCGCCAGCTGAAGGCTGCGGAGAAGAACTATCCTGTCCACGACAAGGAGCTACTTGCAATGAAGTATGCGCTCGTCAAGTTCAGGGTTCACCTG
TTGGGCTCTCAGCCGTTCGTAATTTACACGGATCATGCGTCGTTACGCACTGCGACTCAGTCGCCTCATCTCTCGCAAAGGATGACCCGCTGGCTGTCCT
TCTTCGCGGAGTACAACTTCGAGGTGAAGTACAAGCCTGGCAGGCAGAATGTCCTTGCGGACGCGCTATCACGCAGGCCGGATTATGAGCTGGCTCATGT
AACGACCGTGACTTCGTCATTACCGGATCTGATCCGAACGGCTTATGCCAAGGACGACACTTGTGTCGCGTTGCTGAAGGCTCTGGGGAGCAAGGAGTTT
TAAGACTCGGACATGGATTTGTCAGCGCGGCTGCGCGCGCGGCTACACCGTTATTCCCTCGATGGGGGCCTGTTGTTCTACAACACCGACCCCGAGGATA
CGCCCCGCGTGGTCATCCCTCGTGATGAGGATCTGAAGTATCGCCTCCTCTATGAGGCACACGACACGCCGCTTGCCGGCCATCTTGACCGTGAGAAGAC
CTACAGCTCGGTGAGCACCCACTACTGGTGGCCGAAGATGTATAAGTGGACGAGCACTTATGTGCGCACGTGCGAGACGTGTCAGCGAGTGAAGCCGTCA
CCTCATGCTGCAGCGCCGTTGGCGAGTTTGCCTGTCCCTTCGGGCTGCTGGCAATCCATGAGTATGGACTTTGTGTTTGGCCTGCCGGCGGACGCGGCGG
GCAACACAGGAGTCGTGGTCTTCGTGGACCGACTGAGCAAGATGGCTCACATTGCGGCTGTGCCGGATACCATCGATGGTAAAGGTACAGCAACGCTGTT
CTTGGACCGAGTGTTTCGACAACACGGACTCCCGGAGTCGATTGTCTCGGACCGAGACCCCCGCTTCACGGGCCACTTCTGGAGCGCGGTCTTTGCGGTG
CTTGGCACCAAGCTGAACATGTCCACGGCGGACCATCCGCAGACCGATGGTCAGACAGTGCGCGTGAATCACGTCGTCGAGGACGTGCTCCGCAGCATTT
GCGCTGAGACGCCGAAGCGCTGGAGCGCCATGCTGCCACTCGTTGAGTTTGTGTTGAACAACGCCGTGCACGCCTCGACAGGCTACACGCCGTTCTACGT
GAACAGCTTTTCTCATCCCCGCGTCCCGCTGACGCCGCCACGTGGTGGCCTCGGGCTTGGTGGGGGAGGAGAAGCCGATTTAGCTGATCGGCTAGCCGAT
GTCAGCCCGGCTACTGTTCGTAAACAGGTTGACGCTTTCTTGTCGACGCGTCTGAGTGTCTTACGACATGTCCGTGACGCAATGGCTGAGAGCCAAGACA
AGCAAAAGGAACATGCAGATACCAGGGACAGAGGCAATGTTGAAAGTTATGAGGTCGGGGACCTGGTGTTGCTTAATGCTAGGAACCTACCTACACATGC
AGTATCTGCCGTCTTCAAGACGAGTTGCGCCCGCGCTTCATCGGACCTTTCAAGGTTGTGGCCAAGAAGGGCCTTGCGTACACGCTCAATCTTCCGAAGA
AGATGCGGACGCACCCCGTCTTCTACGTGGGCTTGCTCAAGCCGTACCAGGACCCGATGCAGGTGCAGATGGAGGCACCGAGGGTGACGAGGTCACAGGC
GCGGAGTTCGCGGTCGCCGAGGACGCAGTCGCAGGCGTCGAGGACGCGACCATCCACGCGGGCACCGCAGGCACAGGCAGAAGAATCGGCGCCGGAGGTG
CCGCGGGCACAGCGAGAGCCGCAGGCGCAGGAGGCGCGGTAGTCGGAGCCTGCATGCGGGCCAGGAGGTCGAGCTGACCCTGAAGCACAGCCTGCTGACG
CTGTAGCTCCCCGAGCTCCCGGCCACGTTGCTCATCGCGATCGCGATAGTATCGCACCCAGTCCTCCAGGACCCCAAGACGGTCCCAGACCGCTCGAGGC
ACCTCGATCCATCGCGTCCGCTCGGCGAGCTCGTCGAGTTCGGTGGCAGTCCGGCCCAGACGTGCATCAACGTCACGGATATGATCCCGAATGCGACCCG
CCTGCTGCCGCACCTCCAAGAGCTCACTTTGAGTCGCAAAGGACCCCACAGCGGCCTCCACCGGCCCTGCTCGATGAGCATGGGAATCTACATTACCATG
TGGAGCGCATCCTGGCGAAACGGCGGTGCCGGGGTCAAAACCAGTATCTGGTGAAATGGTGAGGGTACCCTCACTCCGAGAACTCATGGGAGTTTGAGGT
GCCCCTCCGCCAAGACTGCCCAGA