Description :
From Genome Similarity Track
Location :
Scaffold_5:103108- 104820
Transcript NameFunction/comments
Physo_128538hypothetical protein

Sequence
1712 bases(100 bases per row)
CGAATATTCCACGGATGAAACGCTTCCGAATCCGGTGAAAACTAATAACATATTAGAAATAAAGGGCTTATCAGGATAAGGATACAAGCGGAAGGAATTT
CCTTTTGCTTTCGACGGCGAGCGCGACGTACTAAACTACACAGACGTCAATATTATCAGGAGCAGCCGTTTGCAGCGATCTAGCAGCGCTAACGAGCTCA
GAGCGCTCGGTAACAGGCAACAGAATGATGATGTAGCAGGTTTCACGGGTACTTTAGTATAGAGGGATCAGTTCGGGCGTGGCCCAATTCTATGTGCTTG
ACTTGGTGTTTGTATGGGCCGCTGAACCGCTGCATTGCGTCGCTTCCCGACGCCCTTTCGAAGCCCAGCCGGGCCAATCAGCGCGCGCGAGTGATCAGCA
ATCGGGTTGAAATCTTTTACCAGCCTCGGTCGTCATGGCTACAGTACTGCACAACGATACAGTCTCCTTGCCCACCGTGACTGCATTGCACCGCACGATG
ACAGCAATGCCAGCAGCAGCAACATCCGCCATCTGAAGGCGTGTGAGTGAGCGAGTGAGTGTGAGCTCTGCGGGGCAGCAGCTGCTGCTTGAGACGCGGC
CGCTGTCTGGAACCGACGTTGAAGTGAGTCGCCCCGTTCGTAACTCGGTAGCTTTTTGGGCACGCGCCTCGTAGTTCTTGCTGCTGCGCGTGCCTCCTGC
CAATTGCAATCGGAGCTCGCGTAGTGACCGTTGGCTCTGAACTCGCCTCAGGAAAGGATGGCTCCACAGGTTCGTCAGCGATTTCTCATCCAGCGTTTCG
CCGCGCTTCCGAGCGATTTGCGCGTTCGTCAGGACGCCCGCTCGGTCGGCTTTGCCGTGTCGCTCCAGGCTTGTGCTCTTTGGTCGATCCTGCTGCAAGA
TCGGGGTTCAAATGCTTCAGCACTATCCACACTCGTACAGGGCAAAACTGGCACGACATGCTATATTTCTGTCCTCTCCTTTATAATAACGCTTACCTAC
AGGCACGTGGCGCCGAACTGCGGCTCGAGCTGCATGTCGATGATCTTGTTGAGCAGCGAGAGCAGCAGCTTCTGGGAGATCTCCAGGAAGGTCTGGTAGT
AGTGCGACTTCTTGTTGAGCTCCGTGGCCGTGAAGTCCACGAGGCCGTTGATGATCTGCGTTGTGAAGGCGCCCGTGTTGTGCACGGCGAAGTCGAGGTT
GGTGATGAGGTCCCAGCCCATGGACAGCTTGTTGACCTTGGCGTCCTTGAAGTTCTTGTAGATGGCCTTGGTCAGGCTCGCGATGTCGCCGCTCAGCGCG
CCCGTCATGATGCTGGTCATGGTCAGGTTCTGGCACACGGACGTGGCGACGCCGGGCGCGCACTCGTACAGGTTGGCCTCGATGTTGGTCAGCACCTCGG
GCTTGCTCACGGCGAGCGCGACGTCCACCGTGACGACCTGCGGCCGGCACTTGATCGGGTGCAGCAGGTCGACCCAGCAGATCGAGTACCACTTCTGGTC
GAGCTGCGCGACCTCGACCGTGAGCGTGGCCTGCAGCGCGATGGTGCCCGTGAAGCCCGTGCCCAGGTCCAGCGAGTTGGTGCCCGTGACGTTGACCGGC
AGCGGCGAGATGGTCATGATGCCCGACGCGTTAAGGAAGTTGATGGTCGGGGTGGCCGCGAACGTCACGCCGAGGAACGAGATGTTCTGCGTGGCGAGCG
TCTGGTTCTGGA