Description :
From Genome Similarity Track
Location :
Scaffold_238:10309- 11534
Transcript NameFunction/comments
Phymu_g7318alpha-ketoglutarate-dependent sulfonate dioxygenase, putative

Sequence
1225 bases(100 bases per row)
TCGAAGTACGGGATTTCGCCGTGCGGCGTCACTCGGATCGCGTGGCGGTTGCCCGGCAAGTAGTCGAACGTGGCGTAGTGGAACGTGGAGCGGTTGTCCC
AAATGGCCACCGCATTCTTCGTCCAGCTGAAACGCACCTGGAACTCGTGGCCTTCACTCACGTGCTGGTacagcagtcgcagcacGGCATCTGAAACATT
CAAAGCAATTAGCAGATAAATCTAAAAAAAATCTCCACTGAAATCCATTCCCCACCCGACTCCGCAGTAGATAGCTGCACAATACGCTTCGTGAACGCAG
GGTTCACATACAGAGTACGACGGCCGGTCACAGGGTGCGTGCGTACAACCGGGTGCTCAAATTCCACGGGCGGACGACGAATCACTTGTCCctttgcagc
agcagcagcagcttgaggctatcggacagcagcaacgaatTAGTTCGATacaataaaaataaaaactCTCCATATATCTCCAACGCCAACACTTACAATG
CCCGTGTGAATCGCCGTAAGACCGGAGATGAACTCCCTCATCGGAGGCGTAAGACGGTCGTACGCCTCGTAAGCAGAAGCCCACAATGTGTCACCGCCTA
CGGGAGGGTTGGTCAATACCTTGAAGCTCGTGTACGAAGGCGGTTGACGCTCGTTGGACACGTCGCTGTGCCAGGCGTTGAACGGGTCGTACATCTGGCG
CTTGAGGAATCCCTCGCTCGTCTCGACCGAGTTCTCCACTATCAACACCTCGTGGTGGTCCTTCGGGTGGCCCAAGTTCTGGTGCACGTGGAGAGGTCCG
TAGTAGCGCCCgagctccagttgctgctccacgtTGATCTCCTGGtctcggaagaagacgacgccgcGGTGCGCGATCAGTAGAGCCAATTCGTCGCGCT
GTTCGTTCGTCAGCTCATGGAGTTGAATACCCGAGAGTTCCGTGCCGATCTTAGGGGCCAAATGCTTCACCGTCGCGCCCTTCAACAGGTTTTTGAACGT
CGGGTCGGCTTTGAGGCCTCGGTCCTCCACTGGGAGCACGGGGATCGGGTCGTACTTGGTTTCAGGGTACACGCTGAGCAGTTCCGGGTGCTCAAACGTG
GCGTGCTCCACCTCTTGGTTTAAAGCGTTCTTGACGGCTATAGGCTTAGCCTTGGTATCCGTCTTCGTGGTCGAGTCGTTCTGGTGTTGCGGAGCCATTG
GTCTTTCGTGGTGATGAGCAAATTG