Description :
From Genome Similarity Track
Location :
Scaffold_21:103082- 131261
Transcript NameFunction/comments
Phyke_g1377hypothetical protein PHYSODRAFT_475090
Phyke_g1378hypothetical protein PHYSODRAFT_470774
Phyke_g1379hypothetical protein PHYSODRAFT_309039
Phyke_g1380hypothetical protein
Phyke_g1381hypothetical protein PHYSODRAFT_468885
Phyke_g1382hypothetical protein PHYSODRAFT_321807
Phyke_g1383hypothetical protein
Phyke_g1384hypothetical protein PHYSODRAFT_309032
Phyke_g1385hypothetical protein

Sequence
28179 bases(100 bases per row)
GCCACCGGCTGGTCGAAAAAGggatgttgaagtgcctGAGCTGCTGTGAGACGACGACTGGGGTCGTACTGCAGGAGATCTTGCACGAGCTGGATTGTCG
CGGGTGGTGTGCCTGGTGGCAGCAATCTTCCCCAGGAAACAGGAGCACTCTTGGGTAGCCGCAGTTGCAGGTGAGAGGCCATTGATGCGCCCTCAGGCCA
TGTCTTATTGGTGGGTGGGCCCAGCACTTTACAGATCCGATAGAACTGGTCTGCCTCCGACGTCCCAGGAAACAACGGCGTGcacacaagcagctcgacT
AGAATACAACCACAGGCCCACATGTCGATTGGGCTGTTGTAAGTTGTTgagcgcagcagcagctccggtGCGCGGTACCAGCGCGTCGCAACGTAGTCCG
TAAACGGTGGTCGCGACCGGATCTCGCGAGCTTGGCCCAGGTCAGCGATCTTGAGGGTTTCGTTGTGGCACAACAGATTCTCGGGCTTGATATCACGATG
GAAGTAGCCATGCTTGTGCATATGTGCCAAGCCAGAAAAGAGTTGATACATGACCGAGCGAACTTGAGCCTCCGATAACCACAGATGCGAAGGTGGTGAG
GACCACGATGAACCAGACGCTTCGGATATCGAAGACGCTTCATTCCCTGGATTGATAGAGTTGCTTCCTCCTTGACATTTGAGATGGCGCATGACTCGGA
AAAGCGATGTCTGCATGTACTCGAACACGAAATAGAGCTCCTCCTTGTCACGGATGACTTCCTTTAGTAGTACAATATTTTCATGGCGTAGCACTCGCAG
CGACCGTAGCTCCCGCAACTGGAGGCATTCTTCCCAAGTGGGAAACAatgcttttatttttttcaCGGCCACCACCTCGTGAGTCTTGAGGCTGCGTGCC
CGCCAAACCTCGCCAAAAGAGCCATCACCCACCCGCTCCAGTACCTCATAGCGGTTCATCTGCTCTATTTGATCTGAACACGGCTACCTGTATTAATAAC
CGAGTTCAAACTAAGTGGACACATGATTAGAAAGGGGCGTTATCGTGTTGCGGATTGCTAGGAATCTGTGCGGATACTCGCTTCTATGAGGTGGTGGTAA
TCTTGTTGTAGTTCTCAATCATCCAGCGAAGTGTGCGTGCTACCGTATCGATATCAACCTTGTGGAGCGCACTGTATGGGGGCGAGTAAATGCGACAGAA
CGTCAGTATTAACCACGTTGGGAGGTGGGTGCGCCTAGTAACAAGGCTTGGCTTTACCTGACTGGAAGAACTGCTAAGTCAGTGGACTGGCGTAGCTTGT
TAAAGATATCTTCGGCTCCTATATTAACACGACACAATGACGTCCACATTATTAACCGATGAAGTGCATGCATGCAAAATTCGATTCACCTACCTGGTTC
ATCCATTTTGTTCGCGACGATAAGAGACGGGCGCGATGAGATGCCAGGGGCATAcaactccagctccttttGAAGATGCGCGAAATCTTCTAACGGATCA
CGCCCCTCGGAGCCTGCCGTATCAAGCACGTACAGCAGAATCTGTTCAATGGGCAACAATCACACAATCATGTCAACTAGCCATTCAAAACGTCAATATG
AAACCGCCTTTCATTCCGTACTTTGGTGCGCTCGATATGACGTAGGAAGTCATGGCCAAGTCCAACATTGCGATGAGCACCATCAATCAGCCCTGGAATA
TCAGCCACACTCAACCGAAAAGTGTCTGGGAACTCGACAATTCCGACATAAGGGTGGAGCGTCGTGAACGGGTACGGTGCAATCTCAGGAGTCGCGCGAC
TAAGCACACTGAGCAAAGTCGACTTGCCAGCGTTTGGGTAGCCCACAAGTCCCACATCTGCAATGGTCTTAAGCTCCAACTCGTAGTACTGCGACGTGCC
TGGGTGGCCTGTTCCTTTCGTCTCCGGCATATGCTTGCGCAGTCGCCCAAACTTGGTCGTCTTGCCTGCCAGGATACGGTTGCCAAGTCCAGGTTTGCCA
CCTTGAGCTGCGAGGAACGTCGACCCAGGTTTGTCCAGGTCGCACACCACTTCCATCTGATCCACAATCTCGTACTCGCCGTTCTCCAACTCGCGCTCGT
AGCGCTCCACACGCTTCACCAGCGTACCACACGGAACTTTCACATGGCAATGCTTACCTCGTCTTCCAGCCGCATCATTCGCTACAACAGAAACCCAACA
GCATTAGTCCAATAATAGTAATACACAAATAGTAAGTAATAGCAGTAGTAATAGTACTACTACTAAGCAGCCCTTACACATGCCGTTGAGGCCTGCTCCG
CCCTTAAAGTGGTGCGTGGCATTGGCCAAGTTCTGCATTTTGCCGCTGGCTTCGATCACCACgtctcctcctgctcctccgtgTCCTCCATTGGGTCGTT
TCCTGGTCGCTGACTCGCTGAAGAAACTAGCACAGCCATTGCCTCCGTGGCCACCGGTAGCTTTCACTCGGATGCGGTCTACAAAGCGGCGCTTCGAGTG
CTGAGCGCGACGCACGCGGACCTTCTGCTTGACATGCTCCTCTACTTGGCgcttgctggtggacgccacgtcgtcctcgtcatcgagCGTCCAGAGGTCG
TCGTCAATGTCGTCAATGTCATCCCAGTCCAGCTCCaagtcttcgtcttcatcttcgtcgtcgctgtcactgcttTGCGCACTGAATAAACGGACGGAAG
AGCTGCGGAACGTATTGGCACGACGTGCTGGAGTTGTCACGAGGCCTCGTAGCAGACCCGAGACGCGTAGCATCTTTGGCAGATGATGTCTTTTGGTGGC
CACAGATACTAAGGTGTCGTTTAGAAATATTATTTCTATATTGAATTTCTAATTGCATAATACGGTATCGGCGTTGAGATTCTCACGCTAGATGCCCGAA
GACTTTAACAGTTTGTGAGTGTACTAAGTGGGAAGGAGGAGGATAGGACACTAATGAAGAGTGATATGTATTTGGATGCAATAGGTATGAGCGGCTGGTG
GTGCGCCGCACACCTAAGAAGAAGCGAGTGAAGagaattgcagcagtggaggaggcgaCAGAGGATAAAACACTAGAGAAAACGTCGCAGAACAGCGAAA
AAACTCAAGAGGAAATCGAGGTTCTACCTAAAGAGAGCTCGGCAGTGGTTCACACGGTAGTGGAAAAACGAcgagagcaacaagaacgcGATGCGCTCGT
CTCTAAAAGCGTGACCCGACTGCGTCTTGCCAGGAATTTGCGTGGTTTCGCTCGGTTAAGTAATAATTTCAGTCCCCACCGCCTTGCATTTCAAATTTGC
ACTTCAAACGAACAAGAAGTGCAGCAATTCGTCGAGCGATATAAGAAACTTCGAAGGCAGCGGAATATACGACAACCGCTGGGTAGCAAGGAACGAAAGT
TTGGGGTCAAACACCGTACGCGATTGGAAAACATCGCAGCCAGGTAAACGAGTGGTTATCCGTAGATAAACTCGTGTTGCAGTGTCTAACCAACAGTTTA
CGTTTAGGTTGTACCTAAAGCGACTTGGCACTTTTCACCATGGAATCACTACGACAGTCGCAGAAGGCAAACATCGTCTGGTCGATGAGTTGCTGTTCTT
TTCGCCACCAAATACTGAACTTCAATCTCAGATTGGTTACGCACAAGCCTCTAATGTGGTCccacttccaccacagtTTTGCCTATGACATTCGGTAAAC
GACGGTAAGGTGAATAACACAATATGATTTTTTTTCATATCTATAGCCTATTCATGAAGACCACTAGTGATGGAACTGCGACTCATGAGTAATCTTGTct
ctgtggctgcagcatAACCGTCTTTGGAGAAGGCAAAGCCATGGTAAGCTTTTTGTGCTGTCGCTTTTCGATTCTGAATCACTTTGCCGTTTGTCGGAAT
GACAGAACCGTGCTTCTTGGACGTCCTTGTGCGAGGAAGTTGGGCTGGCACTGCCACCGACGAGTCACTGTTGTCATTCCACTGCAATAGTTTTCGATCG
AGGTTAAAGTTGATGACCTCCTTGGCTAAATGCCAATACTCGGGGAAGATGATAGACCTGATGCCGTTCAGGAGATGCACATACATGAGTGATGCCACCG
GTACAAAAAGCCACAGTAGCCAGAACGACGACAGACTGAAGGCTTGTTCTGGTGTCCGCTCCCACGTGAGATCCGAGAGAAAGGTGATATGTCCAGCAGC
GAATGCAACGAAGAGCCAAACCCCAAAGGACCCAGCGTAGAGGATGTaattgaagaagtggaagctGTTCTGGAACATAAACAACTTGGAGTTGGCAACG
AACACGACGAgggtgaagacgacaaaGCCCTCAATCCACATTGCCGGAGTAGCTCCTGCATAGCCAGCATTGCCCATACCGTGAATAGTAATAAACGTGA
TCACGATACTCTCCAGAATGGCGCCCATGACCCACAGTGAGAAAATGCGAGTGTTGATGTCCTCATCTCGAGGACCCGCGAAAAAGAGTTTGGGAAATGT
CATGGCTACATCGTCATTCACATCTTGATCCAAGATGGACGCCGCAATAATCGGAATTGCAGTGAGTGCGACGTTATACAGCTGCGTACCAGCCTCCAGG
AAAAATTTCTGGCCTGAGAATCCGCACAATAGCGTGTACCAGTATTGAGACGCGGTGAAGAGGATATTCTTGTAGAAAATGTACAGCACCAGCTGCGCCA
TGCGTCGGTAGTTCCAGCGACCgtgcacaagcagcagccgctgcaaGAAGCGGAATTGTGCGATAGCGTAGTCGCTGGAGTTCACCGCCTGCATACCTTC
TTGGCCCGAAATGCCAACCCCAATGTGAGCTTCTTGAATCATGGACACATCGTTGGCTCCATCACCGATTGCAAGGGTCCGGACCCCAGGCACATTTTCC
TTGATCAATGCGACCATTTCAGCCTTTTGAGCGGGAGATACACGGCATGCGATAACGGCTTTGCAGTACTGCGAGAACTCGGCGAGCAGGGGACGGCACA
CTCCGCGAAGTCCGTATATGAGCGTCTCACCGTCGATAACAAGAGCAAGCTCACGGAGCTCACCTCGTGTGCTTGGAGGAGAAGCTAGGTAGACACTAAC
CTCACCGCTACGGATTCCAATCTCTTCTCGCAAACTGGCTTCGAGTGCCTCGACACTCGGTGAATTTTTCGAGTTCATAACGAGGAGTTTCATATCGTTC
GTGACGAGCTGACAGGCGAAGCCAATATTGATAGCAGTCTCCTCCTTGTCACCAGTGAGCACCCAGATCTTTATACCTGCACATGCCAAGTTAGCGATCG
TATCCGGAACACCTGACTGCAGTTTGTCTTCGATCGCTGTAGCAccgagcagctccagattGCATTCGATCTCATTCATGCATTGGTCGATGACATTTGG
CTGATCTTTTTTGCGCTTGTCAATCTCGGCAAGGTTGTTCTGTGCGTCATGGAAGCGTGTTGACCAGTCTGCATAGTACGATGGTTTGATCTCGCGCACT
GCGATCGTCAGAGTGCGTAACCCGTCCTCGGCATAATTGTCAACATGACGTCGAGTGATGTCTTGGAGCTGCGAAGAGGTAGTGTCACCTTCTCTATCCT
TTGCCAGCAATCCGAAGATAATCACGTCTGCACCTTTCGAGTACAAGAAAATCCGGCCATCTGGGTGGCGAATGATCGTACTCATGCGCTTCCGCGTGCT
GTTGAATTCCAGAACATCCAGGATCTCATACTTATGGGGAACGCCACGAACTTTAACGTGCGCGATACCCGGGGATCGATTCACGAATTCATACCCGAAG
TAACCGGCGCCAGCCACCAGTGCCTGCTCGtctggagatgaagctgaaagTGTGATTTCTGTCGAGTTTTCATGACGTTCGGGAATGACTGTGTGGCATA
CCGCAAGGTGTGTGAAGAAAGCGTCAATCCGTCGCTGTTGTACAGAACCTGAGTCGCCTTTCATATCGTTGAACAATTCTGGGCCGTCAAAATTCACGTA
CGGCACTTTTGGTCCCGATGAGTGCGATGTCATGTCCGGTATCGGTTTTCCAGCACGCTTGAGTGCTGCCAACCCAATCTCCGTGGTCCCGTTGCCGTAA
GAAACACCGCCGATAGAGCATTTCCGGAACTCCATGACATTGCACGTCAGTGTGCCGGTTTTGTCTGAAAATATGTACGAGATCTGCCCAAGCTCTTCAT
TGAGCGACATGGAGCGTACCAGAGCTGGTGTGTCGGTGTCCGAGTGGTAAATTTTAATGTCCCACTGAATGAACTGCGCTTGGAGATACTTAACCATACT
CATGGAGACCGCGAGCGAAATGGGCACGAATTGATACATGAGCAGAAGATAGTAAAACAACATGATGATCCAATCCACAAAGGCGCTGTTGTCGGATACG
CCCAATTGGAGGTACCACACACTGTCATTGTTTGTTTTCCAGGCGACTGCTCCCGTTGCCCCCGCAGCGCTGAAAAGGAGTAAAATCGACAACAAGACCG
CCGTGTACTTGTTGATGGAATGATCCATGGAGCTCATTTTGGACGGAGGTGCCGAATTGCTCATCATGATTTTCGTGTCTTTGCCGGTATTGAAAACCAC
ACCGTGGACCCAATCGGTATTACGAATGGTACAACCTCGGAGGATGATACTTTCGTATGGGATAGAAGCTTTTTCTTTGCCTTGGAGCTCCAAAATACCT
TGGAAACTGTTTATGGCATTATTGGGCTGTTCACATCGGATGATGCCTTTCATTTGGAGCAAGTTGTCGATGGACCCCATTTCTGCAAGAGTGCATTCCA
TTGCTGAGCGAACTTTCATGTTGGTTTCTCCATCCAAAGACTTTGTCTCAACATAGCAGATACCACACGGAGGTTGGTTAGGTATTTCACTCACTGCAAC
GACCAGGATGTCGGCTGGAACAAGACCGCGGTTAGTGACTTTGACAACGTCCCCCACTGCAACGTCTGCCCACGTCGCTGAGTTGAACTTCTTGGTTGCA
CGGTCGAGGACAAGAGTTGGACTGCCATTAGCAACACTATCAGCTTGGTGCCGTTTGTGGTCTTCAAGGATTGCGAAAACTCCGTCAACCGTGATGATGA
AAAGCAATGGTGGTAGTGATGAAGGGTTgccgttggtgttgctgatATCCGGGATACATTGCAAAATGCAAATGAGAAGGAAATAGAGGTTAGAGAGTTT
ACGGAAACTCTCAAAGAGGAACTTGGGCAGGAAACTGATAATCGTGTACTTGGATGTGATAATGAAATTGTTGCAGTAACCGGCTTCAACGTTGCGCGCT
GGGTCGTTTAGATGAACAATGCGGTACGCGCCAGCATCGGCGGGCGTACCCTCGCCCATGGCTCAGTCAGTTCGTCACGTACAGCCAGAGATTAGACTGA
AGGAATGGGGAGAGTCGAATGCACGAGAACACGAGGGCTGATGCAGGCTAACTAACCACCAGCTCTGAATATAGTGAAGGGCTTTCGAGATGAGGAGGAG
TTTCGTGCCCTGCTGTTCAACGGAGCTTTTAAAAGCAACACTCAGTTATTTATATGGAGTTTATGTGGAGTATGTCAATGGAAGGCGTGGCTCACAGTCT
ATCTATCCATCCACCATACAGGGATCGGGTACCTAAAGCGAGAGGGTGAGAATGCAGCGACTCATCTCAGGATGCAGCCACTACTGTAGATAGTGTTTGT
CGACATGCCGTTTAACACACAAAGCCAGACAGGCTGCACCCAAACAAAAGTTGCCTTTTAAAGTCTCCCCTCTcgctccacttcaacttgtcaaCAGAAA
ACGCTATACGACCATTACAATCCCTCTTTAGAAAAAACAAGTAAATATCAACTCCATACATAATCTTCTTGGAATGTACAATCGTATTGGTCCACTAGTC
GCCTCAactccacttcaacttgctgtctACCACTCGCCACTCCATCACTTTCGAATTTGCCACCCGGAGCTCAAGCGGATGAAGAATCAACGGACCCGTC
GACGGAAACTGCGCTTCAGCTCCACGAAGGACATCGTCCCAGTGGCGACTGTGAGGCTGCAGCCCCATCCAGTCAAGCGCCGCAAGCGTCAAACCCGCGG
GCAGCGCAGCCCCAAGAGCGGCTCAAGAGCAGCCATTGGCCTCCCAACAGCGACGTGGAGCTTGATCCAAGAGCTGTTTACAGCTGCCAAGAGTCTGGGG
GATATGTAAGAAAGAGAACTGAGTAACGTCGGCAGAGAAAAGAGACTGATAACGGAGTTGTGAACAGAACCAGAGTCGTATTGagactgctgaaggagca
tGAAGACCTACAAGGCGCTACGGAAGGCACTGCTGTTTTCCCCATCTTTGTACCAGCAAGCGAGATCTACATGTTGAAGGGTATGGTTATCTCGTGAGCT
CGTTGTTATCTCTTTCTTGGCTGATAAATGCTCTCCAGTGCCTCGGAAGAGAAGGATCTACGACGTGCTGCATGTGCTAGAAGGTGTGACGATGCAGTTA
ATGGTATTTACTGAAGGTGGGGCTTACAGGATGCGTCTTGAATACTGCAGGGATTGGAGTGATCAAGAGGGTTCGTTGGAACGAGAGTCGGAAGACGAAA
GGGGGTTCCTTTCTGTACTATGGGAAGGCTGCAGCGGTTCAGCGCCTAGCAGAGATCAAGCGCGAGTCAGCTCAGGTGATCATGGAGTTCCGTCAATCTT
GTACTTCCAAGACAAAAACTGTGGAGGAAGACAGTGCACTTGTCGAGGTTTTCGAGCGCCAGGCAACACTGCAAAGGTGGCCCTGTTTGGTGTCCACGac
cactttcttcttgagcttgctCTTTCAACAGCATTACCAGGTTGCAGTTGCGCTGCCCGAGGTGAGTAATCGTCTTGTGGAAGCCAAGAAATTTATTGGT
GCATTAGTGCCAACGTCGACTTGGCTCGAGACGACGTACAATGATGTGCATCGTCGAGTGTACGACGTGGTGTCCGTACTGGTGGCCTGCAATTTGATGT
TGACATCGATCACGTCAGATATGTCGCTGGAAACCACGTTTGAGACGGCTGACAAGTGccagcaacgaaagcacgTCCGGTTCAACTACGACATCTTTAC
GGACCCAAGGGCTTTGTTTGCCACTGATGGCTTTACGGCAAACTGGAGTGATTGTGTACATCACAAGTCAGCTCGTGAATTTGCTAGAACGTGTGCATTT
ACCAGTCCTGCGCCGTCGATAGATTTTGAAGATCGTCATAGGCCTCACTCGCTGGCGCGCTGGCAAAGTCTTCGACCCAATTCATTATTTTTCATAGCCT
CACCAATATtcgcaccagcagctaccAGCTTGAAGAAAGAACCAACATGTTTTTTTGGTCCAGCAGGGGATACTGCATCCTTGTCAAAGACTCCAACTAC
AAGCCAACCACAAGCGGAATCAGCCCCACACGTTCATGAACTTTTCTCCCCCTTTGGAAAAGTACTATCGGAGAAGGACGAGTGGTGTGACGAATCGCTG
AAGCAATTGGAGCTTTATGACGCACTTCCTAGCGAAGACAAGATCGATTGGGAGCTGAACAAGCAATTCAAGGAGAGCTATCAAGGTTTATGGGGCTCTC
AATATTCGCCTATAACTGCGACTGACGATCCGGCCAAGATTTCACCACATCAATTTCTGGTTGATCGGGTAGAGGTGAAGGCTACGGGTCTGGAATGTCA
TGAAGTGTTGACCGATGACAAGGCCACCATCACATCGGGCTTCTTTTGCTGACGAACAAGTTTTACGTGTGTGCTTGCTGGGATGCCTTTTGTCTagacg
agaagaagatcagTGTGTTAGCAAGGGTGATGAGTACTTCATAAAAACTCAACTTCTTTCCCAAAGTTTGATGTTATTATGTTTGTGCTTAAAACCCTCT
CTCGTTTCCACTAACATACGCAAAGGTAGGCAAGCACCAGTGCGATGTTCTCATATCCAAAGACCACTGCTACTCAACGGGATGTCTGTAACGCCagagc
agctcaagaagccACTTGAAACGCTATCaccatcatcgtcatcctcccAACCCTCCCAATCGCCTtcgtcgccactgctgctgccgtggCTTCGGAGATC
GACTTCATCGACCTTGCGCACAATGTATTCTGCGTCGTGCTCTGCAGCCTGAGCCTCTAATATCAATGACTCAGCGCGGTTACGTGCTAGCGCTGCACCC
AGCTGACCCAGGATAGACTCGGGAACATGGTTTGCTTCCAGATTCACTGTCTCAAGATGGAGGTTTACGTCCAATGCATCAAGCAGTGCCTGCGCGCCGA
CACGAGTGATTCGGTTGTTCACGAGTTCAAGAGATTTGAGTGTGCAGTTGCAGCGTACAGCCTGCGCGAGAGCCTCAGCACCGCGGTCAGTGATGTGATT
TCCCTGTAAGGACAAGTGCTTCAGTGAATCGTGTCCGTACAATGCTTGTGCCAGAGCGTCCACTCCACGATCGCTGATCTCATTGCCATGAAGATCCAAA
GACTCCAATGTTGCGTTCTTGCACAGCATTTTGGAGAGCGCGGTAGCGCCATCATCACCGATGGCGTGGTCGTGAATGGTGAGCTTTCGAACGGTGTGGT
TAGTCGATAGGGAACGCGCCACCAGGGCGCAGCCGTCAGCTTCTAAACGTTTGTTGCGCAGCGCGAGTGACGAAAAATCCAGCTCACGAACGTCACCATC
GTTGAGGTGGACTCGCTGCATGATTGCACCTAGCGTCGGGCCTACCGtgaacaagaaaaaaaatggtTCGTGTGAGGTACATACTCGGGCTGTAGACTAC
AActgtagttgaagttgttcatgACAAGCATACCTTCGATCTGCGAAATGTGCTTCAGCTTGGTCATCTGTGATGGCGGGTAACTCCCGCGACTGCAGCG
GCTACCACGCGGAGGCTTACTGACACAAGCCCTCGAGCTTCCTGCAGATGACACCGAAAATGCAGAgcccgaagaagaagaacctgAAGTGCTTGCGGAG
GAAAAAGTCTGTTCGCTTTGTGCCTCTAGACCCCCCTCCTTGGAGACAGCAAACTGCCGTTGATCACACGCTGCTGTTacgactgaagcagcaatttgcT
CATCTAGACATTGATTCCCCTCATGCTGCGAGCTCGCCTCGAATACCCCAGCATCGCTATTCTCAGTTTCCGGATTGCCATCAGTCCTCGTCACCACCGA
TGAAGATCCACAATCCAGTGGGGTGGCGATCTTGACCTCAACAGATTCGCAGATCGTGTCGGTGGCACCAATGGGCTCCATCTTCTGCTCTAGATTTTCA
ATCGATGGTTCTTCGGTGGCAGCAGGATTGTCGACACCTGCTGATACTTGGGCAGTTTTGGTCCGTGACATCCTATTTTCTGGCCTGAAGCGAAACGTTA
AACGCTCTCGCTCCGCTTTATCCCCTCTGCCAAGCACTTGACGCCAGTACCGCTACGATATTCATGGGGGACAATACGTGACCACGGGTTCAAATACAGC
GTGTCAACGTCACGCGAGACATCACAAGAATACGTCAGTCCTGATTCGATGGATGGTATTGAGGTGGCCGCCATAGCATCCGATCTATTTGACGCACCTC
AAGGTGGCACTTGGCACGTCGGAGATTGATATCTGGCATTAGCAGCGCCATCTCGCCAATACCCCTGACCTTGTAGCGTCGGCCTCGTCGTGTTCTCGCT
CTGTTGACAAACCAAAGTGCATACTGTGAGTCTTTGCAAAGGATGGGGTACTAGTGCTGAAGCCACAAGTGCTTTCATGTCACCCTTGTAACTCACAGCG
CATTGGGATGGAGAATCGAGGGTAGCCATCTGGCTGATGGGCGTTTGACGGTATACCTAAGCCTCTCCCGCAGACTACCGTTGATGGGCTCAAGGTGATG
GATCTACACCAACTAGAGAGATAGCAAATTCAcgcaagacgaagacagtgTATGACCTCACTTCACTTGTTGAAAGAGTTTGTACTCCCTACACATATAC
GCCATGCCACGGCGTGGCGTTATTTAAAAAGTATCTCTGCTACGGACATGTCCGAGAGGCAGAGCTGCACAGTCGATTGGACCCACTTACCTCTTACGGC
TCTTGTTGATCTCGAGGATGATGGCCTGCAATTCGATACATTGCTCGCGCATCAGCTCCAGGTCATACTTGAGGTTGCGGTTCTCGATCTTGAGGATTGA
GTTTTCATCTTCCAGCGAGATACCGCTGGAACTGGATGTGCTGCCGCTTCCGCTGCGCGtcttcatgaagctctttGCTCTGGCCGACAACTCATTCAAA
CGCTTCACACTACCGCGGCGACCCCCTTGGGCGGATTTGTACGACTCCATGCGGTCAGAGATTGACTTGCCTCGATCTGCGCGGACCGAGGCAGGGTCGT
CACCGAAACCTTCATCGGCATCCGAGTCATCAAGGTCATCGAGATCGTCCACCCACTGACCACCATCGCCATATTCCTTCCCTGACTCGTACTCGGGCTC
CGTTACTGGCCCAGCCTGGTACCTCCTCCAGCCGCGCTGGATCTTTATGATCTCACGGCGTTGGAAGTGGAACTCCTTGTAATCGAGCGACATGCGCGCG
TACGATTGCAAcacaatagcagcagcaattttgtTGCGCAGGCGACGACGCTCCAAGAACCCCAGAGCAATACGCTGGATGGTGCGCGCCTCGTAGTACA
TGAAGTCCGACTTCATGgcctccaactcctccatgACACCGTTCTTGAAGTAGACGAGAGTCTTGCCCATCTGGTACTCCAATGGTGACTTGCGACCAAT
CGACGTCATGAAGACACTGCAAGTGCGACGGACGTCCTTGCTATGCATGGACGGCGGGAACATGATGGCATATCGCGTGGCCAGCTCCTTCGGAGTAAGG
CGACTGGGGTAACCAGAACGTGTAATGCGAATCGCTTCAATTACACCAGCAGAGCGCAACTGCTCCACAATCATGCGCTTGTTGAACTCCGTCGGACTCT
TGTTCGAGTTCGGCTTGATGCAACGCACGTAATGTGAGTTGGTGCACTTGATGTTGTCCATTAGCTGCGACAGCGACGTCTTGAATTGAGTGCCCAAACT
CTTTGGGCCCTTCTTTCCGCGTCCACCACTGCCACGTTCACTTCCCTCCAATGTTATCTCGGCATCTTCAAACAGCTCTGGAAGGAACGAGATGCTACTC
AATTGAATCAAGTCCAGTAAATCCTTCTGTAATGTGTCGCGGTGTTTCTCCATAAAGCCCACCGTCTCATACGCGACCGAACCAGCGTAGTGGTTGATGA
TGAACTGCGTGCGCTTCACCTTGGGGAAGTCAATGCTTTCGTTCACGTCACCGTTCTTCTTTTTCTGGTGGTTAGTGCGGAATTTGTTCACAAGGGCCTC
CTCCGTGCCGCGGGGTTGACGCAAGTGGTCATTCATCAGAGCGATGATGCCCAACTTACCCTCGATCACTTCCACGATGCCTTGGTTATCCTGGTACTGA
ATGTGATCCCACTGCAAGCCTTCACGGACATACTCGTCCTCAACTGTCTTGAACACATCCGTCGTGAACTtctgttgcagcttctcattCGCATAATTGA
TACAGAACTGCTCGAAGCCGTTCTGCACAAAGTCCTCGAAACCGAAGATATCCAGGACACCGATCTGCCCGCTGATTTTGCTCTCGTCCGTGCTGATGGC
GGCATTGATCTTCACTACCATCCAGTCGAACATCTTGGAGTAGATGGTCTTTGCCAGAGCGTCACGGTTCTCCGTTGCTTCTACGGGATCCAGTGGCACC
GTCACGCTGTCGTTGCGCGTAATAACTGTGCGGTTGCACAGCGCTTCTTCAATTCTTGTGGCGGGGAGTCCGAACATCTTAGCGACCTGCGAAAGTGCTG
AGCCGCTCGAAATGCGAGATCCACTCTCCCCACTCTTGTCAAATGACACTTCACCTAGCAGAAGAACACCAGCCAAAAGCTTGAAAAGAATCTTCTGACC
GGGAGTTTCCAAGCCAATAAGAGACAACGACTTCTGTGTGCCTGCAAACCACTTGCTGTCATCTAGACCAGGAATCTGCATTTCCGACAAAGATCCGGCG
TATTGGTACTTGCACTCCGGGTCTAAACCAAACTCCTTGAGCTCCCGGCTGGGCAGACCAGCCAAAAGCTGATAGAAGATGTGGTAGTTACGCTCACCCT
CGGCAATCGACACCACACGAGACTTCTCAAGCAAGTATGTCTCACACTTGGCACCGATCAGCTTGCCACGGTCATtaaactgaagctgcgtaAACTTACC
GAAACGTGAACTGTTGTCATTTCGTGTCGTCTTGGCGTTACCGAACGATTCGAGCAGCGGATTCACGTCAATGACCTTTGCAATGGTCTTATCCTTGCGG
CCACCTGCCACGCTCGCAAGATGGTTCATCACGATCTTCGTGGTCTCCGTTTTACCGGCACCAGACTCACCACTCACAAGAATACTCTGATTCATCTCGT
TTGTCTTCATGTGTTTGTAAGCCGCTGTCGACGTCGAGTACACGTGAGGAGGAAGCGTGTCGCGGTCCTTCCGTAAGTACTGTTCGTGCAAGTGATCGCC
ATAGAGATTGTCAATCCACTTGTACGGGTTCAGCGCGATGACAATGTCATTGGTGTACGTGTAAGGCTTAGAAGCTCCGAAACGCTGCTTCAGGTTGAAC
AGAATGGATGGTTCGTTCAAGAATCGGAGCAGACGCATGTCCTCCACACCCTCCGGGCTATCGTGAAGAATGGCAATCGGAAGCGACTCCACCTCAGTAG
CCGTGGGGCCTGCAATCGCGCGAATGACTTCAGGGTTCTTGAGGTCCACAACACGCTGCTCCGAGTCACCCGAATCCATAAACGCCGTGATTGTAACCTC
TTTTCGTCGTTCGTTGTAATCCACGACTTCAGAATGCAACCACACCTCCTCTTTGTCGGGAATAAAGCACTGAACACCAGGAACAATCAAGTTCTGTCTG
TTTCCGGCACCTGCAGCCTGCTGACGAAGCTGTTCCTCTTTCAGCTCCAACTGCTCCTTCATGAAGcccttgcgcttcttctcgagaCTGAAATTGCTGC
GACGGCGCTTAGGTGGAACCCAGTACGTCTGGCGCTTGCGGATGTAGTTGCCACGACCCGAGGATCGTTCAATCATGTGGCGAGGCTTGAATGCTGTAGG
TGTAGATGATTCTGGAGCATTGTACGCCGGCTTCGGGGTAGCCATACCACCCGCCTTTTTCACTGGGTTAAACGACGAAAGTGACGGCTTTGCCGAGGCG
GCGGAAGGATTGGACGCGATCGATGGGACCGAGTTTGTCGTTGCCAAGAATTGAGCCAGCTTGCTCTGAGAGCGAGGCTTAGTAGACGCAGGCGACGCgg
ttggctgctgcttcatgaaattgttcaacttgttgccgGTGTTGGCGGGTGGCTTAGACgaagtggaagctgcagtctTCGGTTGGTTCTCCTTGTTGTT
ACTTCCGTTCCCTGTGAAAGCCGCCTTACGTTGTGCAAATTTATCGTTGGACGCGGGCTTTGACTGAGATGGAGCCGACACGGCAGGTTTGTTAGTCGCA
GAGGGAGAGGCCGATGATTTAACTGCAGAGGGGTTCGAACCACCAGATGTTGAGGAAGAATTCGAGCCATGTGTCGAATCGACACTAGGTGGGTTAGTCT
TCATGAAAGCTGCGAATTTGTTGCGCGTGTCACCGCCGCTGGGTGCAGGCTTTGGCGGCTGTTTAGGCGTCACTGGTTTCTTCACCGTCGGGGGCGGTGT
CTTCGGCTTTGGCGCCGGCGGCTTACGAACAGAATTGGCCTTCTTAGGCGGTCCAGTAGGGCGATCCACATGCGTCAATGGCGATTGATGGGAAGCCGGG
ACTTGATTCAAGAACGCATTCAAGCGGGACGTgcctccactgccactgcGGTTGTCCTTCTGCTTGTTCGGGGGCGGTGCTGTCGGCGTTTGGAACGCGT
TAGGTGATCCCTGCGGAGATAACATCCCTGCTCCAACCTGCGGTGACGATGGTGGAGGGGTCGAAGGCGGGGTGCCCTCCGGTGACTTGACCATCTTCTT
ACtcgacgccttcttcttACGCGACAAGAACCCTCccttcatgaagctcgtGAGCTTATTACCActgttcgccttcttcacagGTGACGCTCCCTGTGAA
CTGCCAGTAGACATCTGCGACTCGGCATCAGACACCGGGTCTTCCTCGTACTCCCCATTGTACCCAATCGTTCCGAACCTGTCGAACAGGATGGAAAGCG
TGTTGAGTACCGCTACAAAGTCCGCTCCAGtgtccagcagatcgtcaGTCTGGAAAATCTCGCCGTCATTCAGCCCCTGTTTCTTGCACCACTCCAGGAA
GAGTCGGATGTTGGCCTTGGAGTGAAAGACCGTGTTGAGCTTGTTGACCTTGAGATTAGCTGCCGGGTCCACGCCGTTGGCCAGAAGACACAGTAATTGG
CCATCACGCAGCATCACCGACAGGTGCTCGCCATGGTCGTTGGACGTGGCGGTGACGCTACAGACCCACTCCTGGAGCTCCTCTGTGCGGCGCACCGTCA
TGCTTGGCTGAACACGACTCGCGACCTAATAAAACTGCGGGGGGGAGTCCTGTTGAGTGTGTGCGAGTACTAGTACTGAGACTACCTGACTGCACACGGG
GAtaagacgaagaggaggagaagtCAGCGTCCTCGATGTCTGAGACGCCTGCTGTGTCGCTGTTCCCCGATAGCCTGCCTCGTAGTATAATAGAGTGAGC
ACTTCTCGTACAGAGAGGCTTCTCGACAAATGTGCCCGATCAGTCCACGCGATGATACAAACGCAGAGATTCCGCTCGGCTTCTCCCCGCGACTTGACGC
TACGATGGACTGGTGCCTACACTTGACGCTGACTACAGTATTGAACTGGACTCGGGCCGTTGGAAAAACTGACTCGTTGTGCTGAACAAGTGGCAACGGA
CGGGCGGTTGGGGTGGGGTAAGCTCCAGGGCAAAAAATCCCTTCCCGGTTCCTGAGTTGCTTACTATGAGCAAGTGTAGAAGACAGATGGCACAAGAGCT
CTGGTCCCACAACGATTCGACGACTGACCAAATTGCTTCGGTGTGACTCGAAATTGTACCCGTTCGCATACACTACGTTACGCCCAACACCGTTGCAGAT
GCCAACTAAAAGGGCACCCAGATTCCGTGCACTTCCGGGGTGAGACGATTGGGTGCTGATATTGAGGAGAAACATTTGTTTCTCAATATGCGCAGCATGG
GAATGTGTCTGTACAAAATACTTTGGCAAGACGCTTGCAAAACCGCATCAGTTAGAATTAAAACTGCGACGGAGTCCTTGGTATCCGTTAATGCAGTGGC
TACGACCGCGAGTGTTTAGCCATGATAGGCAGCGTTGATCCATTATTATGTTGCCTGTCAATCTATGCTAACAAGAATATCCATAGATAGCTTCACGGCT
CTCCACAAACCACTGGGTCAACTTACTATCCACAATTTTGAGGCCGAGGTCAGCGAATACTGGCGCCCGAGCGTTACCTCTGACCACTGTGTTTGCGGCT
AGAATAGCCGCATCGACGAATTTAGCTTCTTGACTCATAGCCTCGGCGTGGTCTATAATAGTGCGCGTGTAGCAACATGGCATCGCCACCTCATAGAGCG
CAAGACCCGTCTGATCAAGTGGAATTTAGTCACCCGTGCGGGTCGTTCATTCCCACAAGTGCAAATCGACAGCATGCAGCCAGCGACAACATCCAAAAAG
TGTAGCCAAATTGACTGATATCCCTATTGAATAGAATACTACTTCAAAGTAAGTTCTTTGGCGAAGTTGCTTTTTGACATCGAAGATCGCCATCATTTCT
ACCGACGCTTCGTGCTCACAATTCAGCTAGCTAACGATGCACTCGACACTACTGCTTCTCCTCATACTATCGACTTTTTCTATCGCCAATGGTAGCATCT
ATGCAGGCTACACTGTCGGCCGCCAGTTCCAATACATTGGCAAGttctgcttctcctggaCCCCCACTTTAAATAACGTCGCTGGAGTACgaattttgtt
tttttatcATAAAAAAGAATACgataaaataaaatattaACCAGTACATTTAACAATAATATTGCTATTGTTATTGTAGCGAATCGCAGGGGAGATTGAG
ACGAACGTTAACGGCCTCCAGGTGGCCATCTACGACGATGAAGCGCGCTTCTGGAACTACGTCATGACCGACAGCTCCTGTGACTGCTACTGCAAGGTCT
CTCCACGCCATACTAAGGGCGTGTTCAATGTGACCGCCACCAACACCCACCAAGTCACTCCTTTCTCCTTCAATGTGGACATCCACGAACATCTACGCCC
CAGGTTTTGGTATGTGGCGCTGGCTCGCTGTGTCCCTGGGGGCGACACGTACAAGCCATCATTTGCTGAGATTACAGAGTCCAATTTCAGAAAATACTAC
TTTTCGTCGTGGTATAAGATCCACATGACGCAGGGGGACGGGGGTGAGCTcccagtgcagcagcaagggATGCCAGCCATCTACGCAGTGATGACAGCAC
TGTCAggagccgcagcagcagcacaaattGTTGCAGCACGGAGAATGAGACATTCTGAGTCTTTCCACCCCATTatgaagctgctgacgatggtggtgct
tttcttcttcttgtgcaaCGCACTGCTTTTCTTGCACTTCTCCACGCACCAGTTTAACGGGTTGGGTGTGCCGTTTTTCAAGTATGCGGCCAAGATTACG
GAGGTGTTTGTTCGTGTGGGTACGTTGTTGTTAGCGATGCTAATCGCTAAGGGGTGGACGATTAGCAGTGTCGCGCTAGACGGTCAGATACAGCTCTCGT
GCGTCGTATTGGTCATTCTTGGGCTCTACTTGTCCATGGCGATGTCGTATCTTGTTTGGCTCGATCCAGCATCAACATTGTACATCTACGACTCGTGGCC
AGGCCTCGGCATCTGCGTTTTACAGCTAGGTGTGCTCGGATGGTTCGTTAATACCATTCTGGAGACTCGTTCATTCGAGAAAGCCACGGTGAAACGGCGC
TTTTTCCTGCGAGTAAGTACTTGCACACATGAACTTACGACTACTTACTGACTGTCCTGACAAACTTTTTATTTTGGCTGTGGTGACTCAGATTTGCGGC
TTGTTCTCCGTATTTTTTGTAGCTTTGCCTATCATCGTGCTCATCGCGTCATTCCTGTCACCGTGGGTGCGTGAGAAAACAGTAGTCGCCATCACAACGT
CCGTAGACTGCACGATCTACCTGACCCTCATTTACATGTTGTGGCCGTCTCGAGCACCGCGCTACTTCGAGGTACGCAAATCAGCAAAATTACTGGGGTT
CAACCTATTGAGTGCTGCACGGAATGTCCGACCAACTGATATTTTGGAACCTGTGCTCTTTTGTCGACTGAATAGCGTCTCTACTCAGTTTCGTCGCCAT
CCGAGAAAGAGTCTCTGAGAGATCAACACCTCCCTACTGAAGAGCTGTAGCTGGCTACGGCAGTCAAGAATGTTTCGTCACTAGGTTAGTCTTCAAGCCT
GGATATGCGTGCAATCATGCGTGGTTAATAAACTTATTGATCTAGTCTACTCAATGCTGCTCATAAGTCTACATGATTGACTTGTTGAGTAGTTGTCGTG
TCTTCCAGTAAAGCGTAAGTGTCTGTGTCTCTACCTGCGCTAGCTGCGAAAGAGCACGCAGCACCTCATCCGTGCATATAGCTGTTTGAGGATCTGCAAT
ATTCTTGGCTGTCCTCAGTGTAAGATCCTGCCCACCAACACCAAGACGTTAGCAAGAGAGAAACTAGTGGACCAGGCATCGAGCTAATTACCAACCTTCA
AGGCGCTCTCTAGGGTTCTAATGGGCTCTAGCATGTCATCGATATCGAGAGCTAGCTCCTCCAAGACGTCCCGCTCGTCTATATTTCGTGGGGCCCCATC
CTTCCAGTTGCTGACCGCCTCCAGCGCAAGAGCTCGCATCTGCATACCACACACCACAACCGTTTGTCAGTACAGCACAACACAACAGTAGACAAAAGAC
ACGTACCGCTGACAAGTCCGCAACATCGGAACACTGGATAGTGAGCTCCACCGATTGCCGGCCGTCTTCTGCAGGTGTGAAGCGCAAAAGAACTAGACTA
CCCGAGAAGGTTCGCAGTACAGTCCACAATTTATCATGCTGTACCCGGCACGTACGACGTAAATGTGCGATCTCCCTCAGCGGTACGTCCAGCATCTGCC
GTAGGAAGGATACCATTCGCTCGACACGGACCTTGTCAAtatcttcgtcttcatcctcatcgtcgtcatcatcttcatcaccaaaGAACGCTGGGATAGA
CATAATAAATCGCGATGGAGGGGATATCTCTAACGACGACGCGTCTGGAGACGCGATTTTTGCCCACAAAGCTGCAAACGATTCGTTATTGTGAGCGTGA
TCAGCCAGCGCAGCCCACCATTGCACACCGCTCCAGAATGCGGAAGATGGCGATTCAGCTCCTGTGCTCTCGTTAAGCACTCTCTTAACTGGCATACAGG
GCTCATGTTCTTGGCGGAAGGCTGCGTGAATAGCCAGTTGACTTACTGggacttcttcttccattgGTCGACTCAGTTGTGCCAATAGGAATCGTCTGTC
TTGAATCGGGATCGAAAATGACACCGAATTTTCCTTCGAGTTCATGTCGTCCTGCTTACCACGGCTATTTCCTAGAGGGGAAAATACCAGCGAACTGGAC
ACCCACAGAGAGCCTTGGTCTTGTAATGAGAGAGTGTCTGGGTTCAGGATAACGCTCCGTTCACCTTTTGCATTGTGTGTGGATGGATCTGAAAGCGGAA
ATGAGTATGTTGTCACGACTTGCTGGCGAATACGCACATACAGACACAGAGTCCTACACACATAAGAATATCACCTGCGTCAGAATACGAGTTGATCCTC
AACAAATGAACGAATACAGGGTGATACATACCAGTTGTCGAACGAGACGACAGCTCCTGGGTTGACAAAGCGCAAGGAGCATGTTAGTTTAATTGCCTGT
CGATCGAGAAAACTGCCAGTAGGCACTATACACGCTCTCATCTCGCATTTAACAAGTGACCTCACGCCTACAGAGCACAAGGTGCAAACAAATTAGTCCA
AAACATTCTGCACGAACTACACGTACTCTGCAACGAACCTGCTGTTTCAATAAGCCGCAGCAATTCTGTTGCTGAGTGCAAAGATTCGAGCTGGTGATCC
ATTTGCTTCGATTGAGCGCGAAGGGCAGTCGATTCAGTAGAAATCTGTGCAATGTGATGCAGCAAATTACGAACGCGCAGCTCACTCGCAACTTCTGCCT
CGGATGATGTTCCTCGATAGGCATCCTTTCCTTGTTGCTCTGGTATGGTTAGAACAGATGCCACCATCGCGCTCAAAGATACTTCATCCATAGTTATGAC
CCGCCCCGATACGAGGAGAAGTGATATCCCCTGCACGTCTTCATGCATATCCAGCCGCACAATACCCTACAACGACACATTCGTCAGCATCGATTGGACT
ATGATTTGACGATCGATGCAACGCATCTACGATTAAGTTGTCCAACACACCGGGGAGAGGGGTAGTTTTTCCGAGAACGCACCAAAGCGATCATTTAGCA
CTGCAGAGGAATTTGACTCCACGCGCAATGCCTTCGAAAGTAGATCAATGCCACGACATGCGTACGCCAAGCCCCTCGAGCTATAGATGAATGTCGCCAA
GCTTCTGACAAATACGAGCGATTGCACCGTTCGCCCAATTTCCAGCTTCGTCACTGAAACAGGAAAGGACTCGACGAAATCTCCATCGCTCAGATTTACA
ACCGCAACTTGACCTCTAGTTCCAAGTATCAAAAACGCATCAAACTCTTGTGGAATAGCAGCTTTTTCACTGTCAGAGGATCGTACAGAACAAGCAGATG
AAGTTGAACTCGCAAAAGGAACAATAGCCTGGATGGGTTGGCCCAACTCAAGAAGCACACCACTGCGAACCACTGATGCCTTCGCGGCATCCCCTTGCAC
CCACGGATAACAAACCAGCGCAAATCGCAGAGTGCCATCTAAATCTCCTTGAAGGATAGCCACCACACTCTCGTTGTGCGCCACTTCCGGGAACAACCTC
GCCAACAATCCGCTGTATCTTAAATCTTGGCTAGTCAAACACAATGTGCACGTGGACTGTTCTCCTTCCAGATCATCCAGTTCTAAACTCCAATGCTGTG
GTTTAACTCCATATATAGAGCTATTAGGATTCCTCCCAATCACTTTGGAAGGAGTGACGAGGCTTCGCATCAGAGTCAGTGATGGCGATCCAGTCCCTGC
TGGGATGTACTCAACCGACTGAACTCCAGGCAATTGGCCGAACCACTGCACCACTCCACCATCCTGACTGCTTTGTCCTGACCCTGTGCACTCCAGCACC
AATTCGGGGGTCGCCACCCCCACGCCAAGCTGCGACTCACTGGGCAACGTCACCAGCCACAGATTCCCGTCTGCAACAGTCACGAGAAGCTTGCGTTGTT
TATAGTCGGCGAGGCCTGTGATCGGCACCTCGGATCTGACAATACACTGGAGATAAATGAATGCCAATGTACATGCGTCAATAATATGGAGTAAATTGGA
GTAGTCTGACTGAGTACGCACCCAGAGACGTCCATTGACCAGGCAATGCACCAGTGTTGGGCGGAGCTTCACTGCGACATACAGAAGGGGTTCTGCAGCG
GAGACGTCACTCTCCAGCGGCACCAGAAGCGGCGCACGGTCGACTACGCGAGCCAACTGCGTCGAGCAGCTCGGCATGAGTAAAACAAATACGATATGAT
GTTATATCATAATTTTACAGCTTAACTATCATGCGTTTACAGCTTAGCGATATGACATCATATATGTGCTATTATATGATAATTCATATCTCAACCCAGC
CCAGCTATGGAGCGTCTCGATGAGGGTCTCCTGGCGCGCGTCTGCGAGCTTCTAACGGCTCGCGACATCCTCCAGCTAACGTTAACTTGCCGTGCCATGT
CTCCTCACTCTCCTACTGTGCAGCTCGCGTTGGAACGGGTCTTAACGCAGCATTACAGTGACGTGGCGGGCTTCCTTATTTCCTCGGAGTCTCACTGGCC
ACGGTCGCTCTGCGTGCTGCGAGGTGTGGAGATGCTACGTATCAAGGAGGTTCTATCCCGCTCCACCGCTCTGTCCTTCGAAGATGCGGCGCTGTGCTCC
CCCAGTTGCGTCGTCGTGAGCCGCGCGTGGCTCGGCGCCTGGAAGAAACGCTGCCAGAGCTACGAGAaattcctgctgcagttccgACGCACTAAGAGAC
AGCAGAGACTCCAGAatgcagccaagaagaaggacagAGTGTCTTCAACAGAGTGTTTGTCGGTTACTCGAGGCACAGCAGAGCTTGTGGAAGCAGGGGC
GATGATCGTGTGTCCACATGGCGCTCTACTGCCAACTGCTCAGTGCGTCACACGCAGTCGCCGCTCAATTCTCAAGGGAGACGTGTTCAGGGAAATTGCA
GTTTATGCACCGGAACTTCGAGGGTTTACACTGCGCTCGTGCTGTGACTGCAGTATGTGTGTgatggagcaggaggcaCGAGAGCTTGAGGCGGAGGAGA
AAAAGAGGGCGAGGTTTGATGGAGAAATTGCTGGTTCGGAcgaaatgctggagctgttgcagaGGAAAAGCGGATACCCGAAGGGACTGTTCTCGCCTAT
AGATGCGGGATCGAGTGACAACAGGCAACAACTTGCGCCGCATTTGTCGGTTAGTGGACACAGCAAGTACGCCACGTACTTCCTCGTACCCAAGAAGTGG
CTGAACAAGTGGCGCAAGTTTGTACGGAGTCAGGGAGATGACATTCCTGGGCCGGTACTGAATGCTGAGCTGGTTTGTCTGTCACACCAGAGGACGATTG
TGCCGCCATACATCTCAATGTTCTTGTCAGGCTTCTCTCTCGAGCAGTCACTCAAAGTCACGCAAGCGTAAGTTGGATCTACTTTGCAGTACGATGTTGG
TATTGACTAGCAGAGTGCTTACGCTAGATGgttgttgatggtgtttATTTGACAGACTCGGCTCCACTCCTGCCCGTCAGTACGAGATCGTAACGTTTGG
CGAGTGGGAAGCACTATACGACCGGTATTGTGCCGAGTTCGCCGTCGGCTTTGACGTCATCAATGGGGCATATCACTGGAGGACACAAGAGTGCCAGGTC
TGCAATTACGGTATGGGCGGTGGGTCCTCGTCGAATCAGCCGAACTCACATCGCTGACAACCCGACTGTGAAATAACCACTCACCACAATCATTCATCGA
TACTTCGCGGCATACTGAGCCCTAATGGCGCAGATTGCCTTTGTATGGGGAGACTTTCAAATGATCGCCAGACCAAAGCCATGAACTCGTGGGGTTCGAC
CATATAACTACGCAGTACATTTATTCAAACCCTGGGCTGGGGCTGTGAGCATGATCACTTTAGCTATCGCTGCATCCAAACAGCTAAAACGTTAAGTGTT
CTCTGGCAATTTGACACTGGTCCTTAGTAAAGCCTTGGCGTTCTTTCTACCTACGACGTTCTTGTTGTCAGCTTCATGGAATATTTCTGCACACGAATTT
TCTCCCTCGTCCTCCTTAATCCTAGGCATGGCACTATCGACTTTTGTGCCACTATCCTTGAGTTTCGCACGACGGGAAGCTTCCAGCATAGCGGATTCAC
TGAGGCCGCTGAAGCTCAATTTACCACCGAAACGCATCATCTGTGCCTCATAGACTGCGTAATTGTACGCTTTGGTCCATCGTTTCCACACTTCGACTTG
GATTTTCTCCTTTTGCTCCGCCTTCGCTTCGATGAATAATCGTCGCGACTCTGCTAGACCTTCACCGACGATCATGCTCAATCCAAATCCTGTAACAGCA
ATGCACGTGCCAACTAGGAGATAGCCCAACAACTGTGTGTTAATCATCGATTCGGTGTTGAGGTCGTTCAGCCGGATCATGATACCAAGCCACAACGTGA
aaaagagctgcagctgagcgaTACTCGCAATGAGATTGTCGGAATGGCCGTCGTACGGCTGGAAATATAGCAGGAACCACATCGTCACCAGGCTAAGACC
ATCGAAATATGCCAGTGAGCAACAGGCAGCGCATCTCTCAGTTAGCTGAGCTGAAAATATTCGTGCAAACGTAAACGTACCAGACGCCAAGCGCGAGTAA
TACTTGCTCAACACTGCCATTCCCCACGAAGATAATCACACCACTCAGAAAGAGCTTACGTGAAAGATCCACGACTTCAAACCACCAAAACCCGTCCGCA
TCTTTGATATGCACATGGAACACAAACAGAAGTCATATTAGTCAAGAACGACAAGCAAAACGaccacaccaccacccacaTTCAGCATAGATAAACCCGA
GCCGCGCTTGCACAGTCGAATCCTAGAAGTTCaaaacgacaacaacatgagTATTGGCGCTTATGATTCCACCACCTTCGGCAGTTTTGACATCGCTAGC
TTACCGCCAAATTCTTGCGCTTCATGTATTTCGCTAATTCCTCGTCTTGCACCTCGATGCTGTCCATGCCACGAACGTAGCGCCCGTCCGctacttgctg
ctcttccacctcctttAGCCATTTTTTGCGCTGTACACGGAGCTGTGGCTTTCGCAATAATCGCAGGCGCGCGGCGACACCGCGGTCCTGCGCAAGCCAA
ATCAGTAGCCCAAAGAAGAAGGGAATACCCACCACCCAGACTACAACACCCACAGTCGCTACCACGCCGAACAATGCCCACTCCCTGTCGTAGCATACGA
GCCGGCGATCAGCCACAAGATAATACACGTCACCAACTTCTTGACAGTTGTAGACGGTCAACATCGTCTTGGACACGGTCGGGTACAGAAAGAGTGCCAC
CCAGCAGTAAAGCTTTAGGCACTTGTTGCGGTACGTGAGGTAGTTCATCCGCAATTTTACCCTGGCTTGCCACACTCGGAGGTTGCTGCGAATTGTGCGA
TCGAGCATTGCGCCAGAGAGCACGTGCTTCTTGATCGGGCACTCCGTATGCACCGAGCGGAACAATCCTAGATAGGGAGTACAAACTTGGGACATCCCAA
ATCTTCGCTTTAGCGATCGAGTTTCTTTGACCACCGACACTGGGGAAGCGTTGCTGTCAAAGCCTGTCTTTCCTGCTCCCAAATGgtcagcacgagcagc
atgCTTGTAAAAATTATAtgttctccaccagctctGCAGTAGCAAGAACGGATTGAAACTCTCATCGTCATTGCGAATGACGTCGCTCTCGAGTACGGGG
AGCCCACAGCGCAAGCAGTTGCGTGGAATAAGCTGTAATTTTCTACGGTAGCTCCGCATACCGGCGTAGAAGTACGCAGTAATGACGGATATGATGAGTA
CAATCAAACCGACCGTGGCACTTGAGACCGTTTGCAAGCACATGTACAACACAATGTTAGTTTGTCGTGGAGAGGGACAGACTAAAGCAATCATGACATA
ATCACGCACGTGAAGTCGAAGTAAAAATTCTTCGTGATGACGCAGTCAATACCGGCGATCGCGACAAAATCCTAAGCAAATGCAAATGTTAGTTCGTCGT
TCAGCAATTAAGATAGTCTACACAATTGACCAGCTCGCCAAAGGATCATGTTTCCGTACCAGATTAAATTTCTGCGAAACGCTCATGACGTTTTGCACAC
TAGTCGACCACTTGACAGTGAAGGAGCTTTGGAAGTTGCCAAAGATCTGAAAGAATCCGAGGAAGATCTTGAACTTGCTGGGGTTAACTGGAAATGTCCG
TATTGGTGGGGTGACATCCACACCGAAGAGAGTCTTCGTATTGATACGACGATCTCGCTTAAAAAGCGCtttgatcttgttcttgagttGACTCCACCTT
CCCATTACCATCATTGATTGCCTTCGGTACGGCATGCTTGCGCGCCTAGCAAGATTTCTTTCCCCCGTCTTGGCAGCTGGAGCCTTAAGTCGTCGATCAG
CCTCCGCTTTTTCTAGAAGATCAATCTCTGTGAGATCTCGCAGATAAATGCGCACGCTATAGATTGCCACGAGTAGGCCAATAATCAATAGCACAGGAAT
GACAAAGTTTTGCCATCGAATTGACGCTCGAACTTCTGCGTTTGCCTGACTGCATGCTGAAGTACAAATCAAATCCCAGCATCGTGATGAGCTTCCAAGG
TCCTTAGCAATTATTCAACTGAAAGACTTACGTAGACACGAGTTATCTGCGGTTCGCTTGAACCCGTCGGCGCATACGGAGCAAATTGTATGGTCGTATC
CGTATGAGCACGAAAAATTGCTGCTAGTTGATGATAGCGCGAGAGCTTGTAAGGTAATATCGGCCTGGCACGCTCCCTCCACCTACAACAAtgacagcca
cagcaacatcattATATAATGACCGCCGTACCAATAGCATACCACTCAAACATTACATCGCAAGCGTAGAATGATTTCCCCGACAGACAGGAAAACAGAC
GTCCAGCTGGCCAGTACACGTTAAAGTCGATAGCACTTGAGCAATTGTAAATCACGTCCGAGATATTTGCCGTCGGGTTTGCAAGCGCTAGTGCTTTACA
CGGATCCTCGTTTTTCCACAGAGATGGCTGAAGGCAGCTAGAATGCTGCTTCGATGCTGGTGCCGAGAACAGATAGAATCCTTCTTCGGTACGAGGTGAC
ACGGTGCCAAGCTCTTGCGCCACCGTCTCAGTGGCTCGTCGAACTGTCATATTGCATTTTGCGCCGTCAGGACAGTCAAAACATCTCAATCCATCCAAAC
TACGAGAGGCACACCAGCATAACCACATCAGTTAGTGAACAAAAGCAAAATACAATTCGGAGAAATCAGCGCTTGATACCTGAACGTATTTTTCGGACAG
CGCTCACATTCTCTGGATGCCCCAAAAGGAAAATACAGCACAAAGCGAGTCAGTAGCTACGTCTGTGCAGGCAGCATTGGAAAAATATTTGGCGACAAAT
ACACACTTTTGTTTGACTGAGTAGCCTGGTGGGCATGGCAGCATTGTCACGTTCTGGACGAATTTCCGTGCAACTGACC