Description :
From Genome Similarity Track
Location :
contig_46:103072- 104519
Transcript NameFunction/comments
g8179.t1hypothetical protein

Sequence
1447 bases(100 bases per row)
TGCGTTGACGAGCAGTGTCGGGGGCGAGAACTTGCCGTTGGGGTCCCATGAGTCATTCTGCGCGCTAACAAGTGTATCTCCTCCAAAAAGAAGCTGGACG
CACAGTCCAGCCAAAACTAGCACGGAGCGGCGGGAGGCGGAAGGCGCCTTACAGGAAGGCGATATCTGTCGGATGCTCATCGTGAGATGAGATGAGAACT
GGGAGTCTTCAAGCCTGCGGCGGGGTCCGACCAACGTGGCATTTTACTCCGTCGGGATCTCTCTGCGCCCCGCAGCATCGCGTGCTTCGCCACCAAGCCA
GAAACGAAGAGCTCTTCAAATAGGTGCGTAAAACGCCTTGGTGCTCGCTCATTATTCAGGTTTCACTGAGCGCCCTGCACTCCAAAATTACATATGTGTC
AGCCAGCCAAGGCGATTCAGCTCGAAATTCGCCGTTCGTTTCGCCATTGGAGAGAGCTCTCCTCTTGTCACAAGGAACACGACTGGACAAGTAAAAGTGC
GATGGTGGAAGCGTCCTCGCAGCTTCTCAGAGAAGGTTCTGCCCCGCGAGCAACGCGAAGTGAGCGTTGAGGCAGCAAACACGTCGCACCCCTGCAGTGA
GAGACATCCTTTTGCCTTGAGGCAAGCCATCTAGTTGAATACTGAAGCATGTCAGTCAGTGCTCATGTGGCGGCAAGTTGAGTCCGAATCCCCCACCATA
GAATTTCTTACCGCTGCAAATCAATTCGAGAGTGCCATTATAACGCTGCTATCCAGCATCTTGGCAGCCAATACACTCGGTAATCCTACGACAGGCCGCA
GGTCAACGTTGTCAACGCCGTCGTCCTGCAAATTGTCGCCACGACCAAGAAGAATACCAAAGCAAAACAGCGCACCCAGCCACTACCTGACGAAGTTGAA
GTTCTCTTGAGCTCGTTCTGCCTTTTCCTCCAATCAGATCATCTTATCCAGGAATAAAAACGCACCTTCCTCGATACAAAACCAACAAAAAGCCCCGCCC
CGCCCCCTCCGCCCCATGAGCGAGCGCGCGGCCGACGGCGCCTCCAAGCCGCCCAAAGAGCCCGCGGCCCAGCTCAGCGTGGACGACGAGATCGCGACCG
TCATGACCACGGCGTCCACCACCAAGAAGAAGGAGGACATGCGCAACGATAGCACGGGCATCACCGTGGGGGACTCGGCCCACACGCTGTCGGACGTGCG
TGCTGACGGCTTAAAAAATCGTCGCAGAAGAAGAACGAGGAGAACTGACTGTTTTTTTTAATTTTATTTTACGATCTTTTCTTTCAGGGCAAAACGATCC
ACTACTCTGCAGAGCGGATCATCGGCAATGGCTCGTTCGGCGTCGTGTTCCAAGCTCAGTGGAAGAGACGGGCGAGATCGTCGCCATCAAGAAGGTGCTG
CAAGACAAACGCTTCAAGGTGGGGGAACGTTTTGTTTTAAATATGTG