Description :
From Genome Similarity Track
Location :
Scaffold_183:10301- 21012
Transcript NameFunction/comments
Phyag_g3181hypothetical protein
Phyag_g3182hypothetical protein PHYSODRAFT_286375
Phyag_g3183hypothetical protein PHYSODRAFT_506356

Sequence
10711 bases(100 bases per row)
TGCAAGCAGAATCGATAACGCTAGCTCAGGCATTCAAAGAAGAGATGGAGCACAATGCAACTTCTCACCAACTTGCTTTAGATCATGCTACATTGGAACA
AAAGTTTGACGGGGACATGCAGGATGTGATGCAACAACTGGATACAATTCGTCGGGAGGAAGAACAAGAGCGAAATGTTACTGAATTGCGaatgcagcaa
gaactgAGACTTGCAAACTTAAGAGAGTGCAGTATGCAGACGGAGACCTCACAGCGAGCTGATGCTGCTACCTCTGCAGTTCTGTACGTAGATATGTCCA
CGTCACCGATCCAATgcgttgttgatgttgcagtTCAGCATGATACTGCAGACCACAAACCAGAAATATCCACTTCAGCAGTTGGAGCGAATCACGAGTT
AGAAGACGCAAGTGAGGTGGACAATGGCACTTACGATGAAACATTTGAAGAAGAGAGTCGAGTTCAAGTTGAGCTACCAAATCGCGATAAACGAAGTACC
TCTGGTGTACCCTCTTCTGTGGAGTCTCTAGAGGACAGTCCATCGCAAAGAGAGAACGATGACGAGAGTGAAATCCAGTCTGTACTATCTGGGCAAGGGG
GTGCAGACAATTTTGAGGAATCCGGTGTGGCAAAAAGcattgttgatgaagaaagtTTTCCTGGTGAAAATTCGGTGGTGAGTTCTGTTGAATCGATAGT
TAACGATGAAGTATATGAGAGCAATTCAAAAGTCGTGGAAGAAACCAAAGGCGGCGTGTCGGTATCAATGGATTACGACGACGATTTTGAGGTGTCTTCT
CCAAAATTGAGAGCGATGGATAATGCTGTAGGCGAAGATAATATCGAAGACGAACTTGTAGTGTCGGCAAGTAACGCGAGTGAAGATATTGAAGAACAAG
TTGATAGAGGAAATGAAAACCTTACGGCTGGAGAAGAATTGGTTAGTGATGACGTGGAGAGAAGCCCCTACTCGTCACAATTTGAAGACACATCGCGCGG
TGTTTCTTCTCCAAAGTTAAGAGCGGGGGATAATCAGATGCAAGCTATAGGCAAAGATGATGTGGAGGACGAACTTGTAGCGTCGGCAAGTAACGAGAGC
AGTGAAATGAGTGAAGATCTTGCAGAACAAGCTGACGGAGAAAGTGAAAGTGTTAAGACTGAAGGAGATATGGTTAGTGAAGACGTGGAGAGCAACCATT
ACTCGTCACAATTTGATGAGACGTCGCGCAGTGGGTTGATGAAGCCGGTGATCAAGGACATTGTGAAGGTGGTGCACGGATTGGAAATATCGACTGTTCA
GACGCAAACTCGAAATGAAAGAGGTAGTACGCCTACTCCAATTACAGCAGACGATCTGAAATTAAATGCAATGCAGACTTCAGagggtgcagcagcagct
tatATCCTTGACCTTGACCGCAGGAAGCAAGCTGAAGAATCATTGCTTAATCTTCGATTACAAACGGTTGAACAAAAGTTCCAACACGAAGTCCAACTGC
TCGAAAACACTCCTAGACGTGCAAAATTGGATACGCAAGCTGTTAATGAACTCGAGGCACGGAAGGATAATTTAAAAGTGGCGTTTTTAGCGGAAAAGGC
CATCGTTGAAAGCCTGAAGGCTGCGTCAACGGCGCGATTCTACCAAGACCTGCATACGTTTCGATCGCTGTCGCTCGATTGGCCTCGTTCTGTTGGTCGC
GAGAACGAGTGTGACATCTACCGCCCAGGGTATCTTAAGACTTCTGTGCTGGCTGCGAATGCGTCTTCACCAGGTTACCCTGTCCAAGTAGAAACGACTG
TCCCTGTAGATGATAACAaaacttcttcagctcatCGTGACGAATACTCTGATGAATTTGAAACAAATCCTGAAAATGGCCACTCAAATGAAGAGATGCG
CAACAGCGGAGATGTGGAGATTACTGAGTCTGATTCAGTAGTTTCAGAGCACTCTGAGGTGCACGATGACATCGCTAGTGAACCGAGTGATGTCATGCAA
GATGAGAGCGAGTATGCTGAAGACTTTGCTTCTATCAGCGAGAGCACTCCGCACCCAGCGGCGCCGACTGCAAGCTCATCTACAATGAGGACGGATATTG
AAGAAAAAGAATCTGAAAAAAGTGTTCATGAAAATAGCACCGACAAAATCTCAAGCAGAAGTGAAGTTGTCGAAAATGAGGCTTATCTTCACGcttctgc
tgaagaagtgcacGGGGGTGGAATTACTGGTGACGAGGTCCGTGTGAATGATGCCAGCGAAAATTCGAGCGAAAGTGAAATTGTCGAAGATGAGCCTGTT
TCTCATCGTTCTGCTGAAGAAATACCCAGCGATGAAATTGCTGAAGATGTACCGGCCGCTCACCcttctgctgaagaagtatgCAACATTGAGATTACTG
AAGAACAGGTGGTTCCTCGTGCTTCTAAAGACGTGGTTGCACCAGCCCGTTCGGTAATGAGTAAACTATTCGGCAAAAACGCTATTGACCGATCTGCAGA
AGTTGATGAGGGATATGATGTGGAATATGAAGCAGAATcgtttgaagaagagcagaatGGAGAGAGTGAGAACGACAAAGCTGACAAACAGCTTCCTGAA
GTCACTAGCTACGAGGTAGATGAAGTAGAAGAGAACGCACCAGGTGATTCACACCaaaacgatgaagaggacgcAGACGACTCAAATTACGAAGTTGCAT
CTGAAGTTTCTACCCAGCAATCTGAAATTGGTGAGGAAGGagttgttgatgaagaatcGGATCATATTGATGATGAGCACGAAACAATCGGACACAAAGC
GGACAGTGAGAATGATGAAAACAACTACGAAAACGACTATGAGAATGAATCGTTCGATGAAGGTCAACCTGCTTCTGGCGAACTTTCTGgtcatggacaa
gaagatgctTCTTTAATAGACGAAACTCCAGCCGAAGGTACCACAAAGGATGAAGTTACATTCGAAGAGCCTGGgtacgatggcgaagatgctTACTCTG
ACGAAGCTTTTGATAGTGGGTCAGAGTCGTTCATAAATGAAGCGCCACCTGTTTCCAGCACAGTGATTTCACCGATCACACCCAATGCCACGACTATTGC
AGAGGCTGTAGCATCTATCGAAGAGGACAGTGTAAAATGTGAGGAGCTTACTGAAGCGGCGGcgcagcttgaagacgcAACTCCTGTATGTCCTATGATC
CCTGCACAACGTTATTCGGATCCCGCCGTCGAACTAAGTATTAACGAAAGCAAATCTCTGGCCGCTTCTGTGTCAGCGTCGCTATCGCATGACCAGGAAG
GGGGCTCTCTTACAAAGAGTATTGAGGAGCGCAACCGCCAACTTCAAGCATTaaagcagcagattgaagaCCGAAAAAAAGAAATATTTGCCGTCCAGAA
GCAAATGAGAGTTGAGCGACGGAGAGAGCAGCTTGTATCAGAAGAGAAGATTTCATGGGAAGAAATGGAGCATGTCGAGAGATTACTCCACGCAGATGAA
ACAGCGCTGGTGTTGTGTCAACAGCGCAACCGGTTGGAGATTACATATCTTGATGCGAAGCGGTTCGAACACTCTATCGGTGGCAAAGCCCACAACATTG
TGTATGAGCAAGAAAATAATTTGTTGCTTGACTTCGACTATATTGAGGAGGCACAAGTCAAGGAACAACTATACATTTCCAATGTATCGCAGTTATCAAG
ACAAAGTCATACCACCAGAGGATACGATTTGCTTGAAGGATATGCTTACGTTGAACCAGCCGAGCCTATCGATCCAAACGAATTTGCACCTACAGTACAC
GTTTCGGCGGCATCAGTAGCATTCGCTAACCCTAAAGGAAGTAGTCGTGATGAGATTGAAGATGACGCTGAGGCTTATGATAAAACAACAAGGAGTGGTT
CTCTTGGCGGAGAAAACAAACAGGATAATGGAagtcaagaagacgatgaatcCAGCGTCATCGATGGTGAAGAAACTGCTATAGCAACGCAACGAACAGA
TATAATCGCTCCAGACCACAGCGACAAGTTACAAGAAAGCGATGACGAGTGCTTCAGAATGGTTACAGATGATGAAAATGCTCAGCCACACGAAGCTGAT
ATGATGGAAAAGTATCTTCCTGACTCTCGAGGTAAACAAGAAGCTGTGATTCAGAGCGAAACGGGTGTCCATCAGAGCTCTGAGTTGGATATCTCTGAGG
AACCGTCATTCTTCAAACTTCGACAAGAGTTTCCGCAAGATGACATAGATTTACTTACTGGGTACGACTATGTGGAAGTCGCTGAAACTACTTCACCCAT
ACAAACTGAGCAGTTGAACGTAGACCTGCTTGTCGACTTTGACTACGTGGAAATAATAGAACCTGTCGAAATGACACATCTAACCTGTACTGCCAATGAG
GAACTGcgtcaagatggagaaaatgTCGATAACAGTGATGTCAACCGTGAACAGCCAGGTGTTGGCGACAATGACCACGTGAACGAAAACAAACCATCGA
TGCAGTCAGTAGATCGCCAACCTACTGGAGAGTCATTTGGAGTTGATCTATTGGTTGGTATCCCCGCAGCACGTGACGAGGAATCTCCAACAAAAATGAC
GGAAACAACAATTAACGATGATGCCCGCAGTGGTGACAGTTTTGAAAACTCAATTGAGGATGACGAGGCTGCACAAGTGATCGACATACTAGACCCAAAC
AATGCAGTGAACACTGCAATTAGTGGTCCCACATCATCCAGCGAAGTTCACGAGCCACAGGCTTCCCGAAAGGAAGAAATTATTGACCGAGTGGCTGCCC
TACTGTACGCTGCCTTATTCCAAGAACTGCAAGAGGGTACGTACGTTCAATGCAGAAGCTATTGTCCATATACAGGATACTAACCGTTGCTGTGCGTTCT
TAGACATAAGGACTGCCATTAATTACAGAATTGGTGACGTTCCCAACAAGGAAAATATCAAGAACCTAATGGAAGAAGTGACAGCAAACATGGGGACTGT
AGACAATGACGATAACGCTCCAGTCGAACACGAGCATAAAGAAATGGTACGCGATCCGAACGTCGACAGAGTATTACAAAGCGAGCGAGTGACAGATACA
ATTTTCGCCGCCGTCTTCGACGAAATTCTGGACTCAGAATTACAGATTTGGTCCAGCCGATCACCACCAGACAAGCTTTCGCGTACCATTGGCCCGCAAA
CAGCTACCAAACGCAGCATCATTTCTAACATTacggcttcttcggctgtcAAAATGATTCATGAATCAACAAAGTGCGCGCCTAAGCAAGATCCAAGGGC
CCGGGATCATGCACTAACAAAAGTAATCGTGGATCAACTCGAGATCGTTGACGGAGAGGTACGCAGACTCTTATTGTATTGTTCAGTGCATTACTAACTT
GATTCTCATGAATACTTTACCTTGCAGATACGGCTTCCAGTTTTCTCTGCGTTAGAGGTTGGAAACGATTCTACCATCGCTTACGTTCTCTATGACACTA
TCGAAGATCTCGCCCGCGAATGCTTCCGTGCAATAAATGTTTCTGCATCAGGCAAGTACGTGACTGACGAGCCATCGATGCTTACAGCCATTCGTCGCCA
CGTTCAAAGCGAAGTcggcgagctgcttgcaATCCGAGCGCAGTCCGAGCACGAGTTGGAGCGCCAACTACAGCTGATTTCGGATGAGTCGGGGGCCGAA
GCAAGAATCACCAGTGATGTACTGCTGTCGCAAAACTGCGTACCATCCAATGTGAGCAACATCATCTCCAAGGTTCGAACCGATCTCAGCTGGACAACCG
ACGAACTTCCAACAGAAAGCCAACCCACTCGCTCGACCTTATTGCCTCGTACGCCAATTTCCCGCGCCAAGACCACCTCCATCCTCTCCTCGTTACAAAC
ccaacaagaccaagaactgcagcagaggaTCACGGGCTTGATCCTCAACGACCTACTGCGTGACACTGGGttatgttgaagttgctgacgAACTTGTACC
TTACGACCACCGGAATAACTATCCTGAAAAATGATAAATAAATTGCATAACTCGATAAAAGAAATGGCAGCCATCAATTTTGAGTCAACTTTTGACACAC
TACAGTACAAGAGCTCTTCATCATGAGCTCTCCTGCTGTCGTGACGGTTCTACTGGAGTGGCTCGAGTCCCATGGAGGCGTCGACAGTTTGCTGGACATC
CGATACCTGGGCAAGCTTGAAGGTCACGGAGTATTCGCCAGTCAGGAGCTAACCAGCGGCCAAGTGACGCTGCGGGTGCCTTTCAAGCTCACAATGAACA
TCGAGTCCGCAGCCCGATCAGATCTTGCACCGGTGCTCGAGAAATATCCCCAGATCCCTGCGGATGAAGTGCTGGCATTGCATCTGATGCACGAACGCAG
CAAAGGCAACGATTCGTTCTTCGCTCCGTTCATTGCGTCAATGCCCACCACGTTCGACTTGCCTGTGTTTTGGTCAGAAGCAGAATTGAACGAACTCAAG
GGCACAAACGTTCTACTGTTAACCCAATTGATGAAGAATCAGTTGAAGAGGGACTTTGAGAACATCCACCAAGCTGTGGCGGAAGATTTCCCCGAGATTT
TCgcgtcactgctgccattgaCAGTGGAGGATTACATGTGGGCGATGAGTGTGATCTGGAGTCGCGCCTTTGGAGTGAGCAAAGGTGGAAAATATCTACG
TGTGCTGTGTCCGGCCATGGATATGTTCAATCACGATGTGGCCCTGCGCAACCCGCTGGATGACTTTGTATCGTTTGATGAGGAGAAGCAAATGATGACG
CACCATGTGCCGAAAGATATTGCGGCCGGATCCGCCCTTCGCATCAGCTACGGACAATATTCGAatgcgaagctgctgtatTCATACGGATTCGTTTCGC
GAGAAAACTCTCGACGGGCTGTGGACTTCTGGATGAAGATTCCGCCGACTGACCCGTACCTGAAGCTAAAGCAGACTGTGCTTGACTCGAACGAACTCAC
TCGCGAGCAGACATACGACTTTTGCGGTACCCTCTTCGACAATGTTGTCGACGAGAGGCTGCTAGCTACTCTGCGGGTGATCTTGATGAATGAAGAGGAA
ATTCGTCTGTACAAGAAGGTAAATTGTTGGCTAATTAGACCTCTTAGCGATTTTGGTCCTAACTGACTTTGTATCTTGGATTTCCCCTGCACTTTAGGCG
TTTGAGTCGTCGATTATCAGTGTCCGCAACGAATTGGCGGTGTATGAAAACTTGCAAAATAGCTGCCGTCGCAAGCTCGCAAACTATCCTACCACGTACG
TGCAATGATATTTATGATTGCTGTGATGTTTGCTCTCCTCACTCGATTGTTCGCTTCGTGCTACCTGCAggcttgaagaagacgaagcaaCCATGGCAGA
AACGGAGACCGAATCGAAGCCTCGCCTGtcttttgctgttcgagtgCGCATTGAGGACAAGCAAGTGTTCACTGGAGTTATCGACACACTTGAGCAATGG
AAGCAGGTACTTGCATCTGACCCTGGTAAATATCCTCCAAGTATCACACGATCATAAACGTTTTCGTGAGAGTGAAGTATTCTGTTGCGTGAAACATGCT
TTGAGTGCATTTTATTTGTCGTCTTGATGTCGTTGCAAAACTACATTTTTAATAAGATCCGTTTGCTGAGGAACAACGATTTGGATATGTCGAGTATTCT
CACACAGTTAGTTAGTTGGTCAGCTTGCGGTCCAGCAACTGGCGCAACACACTGGATGTGAAGTACGGCAAGCGTGAATTCACTTCCTCATCGTTGAGGT
ACTTTGCACCACCAATGTGGCCATGGCAGTTCGGCGCACCACAACGGCAgtcgaacttctcgtccatgtccCACTCGCTCGTGGAGTAGTCGAAGGTCAG
ATGTTCGCCTTCCGCGATGGGCTGGATTGCAATGAACGACACCTTCGCCTCGTTCTCGGCCATGTCGATTCGAGTGTTGGGGTTGCAACTGTGGTTCACG
AACTCCAGCCCGCCCGTGAAGTCCATGTGCTTGTCCGGCGTGATCTGTACCGTGAATCGAGTAGGCTTCTTGTACTGCATTATCAAACCACAAAAGAAGG
GTGAATCATCCCAGTTCCCCTCTTCAAAGTATGATATCTTCACGTACCAGAATGCCAGGAGCCGAGCCAATGACatcgtccttcttgaagttCTGACCTG
CCACAGCCGACCGCCAGTGCTCGTTTCTGAAGAAGTGGACAATTATTTCATACCACGTTAGACCCCACATCACAATTGAGTTAACAACAGCAATACCTTA
CAGTTGGTCGATGTAGAATCGTCCGTCCGAGCCCTCGGGGACGTAGCGCAGTTTACCAGTttgctgagcttcgtggccTTGAGCTCCGTTCAAGCGTTTG
GCGTTGGTCGAcgcggtggcagcagcgaagtggcggcggctgaAGGAAGCGATAGAGCGCGAGACGAGCGGGACGTTACGGGTCAGCATGGTGCAggcag
gaggtggcggctAGTTGTGCGGCTTTCGAGGAGAAATCGACAGTGGGAAGGTTGCAACGCAGGGGGAATTTACTGCAGTGCAGCCgtgacaatgacgacg
acgcggccACATGATCGTTCCTGCGCTCCCCCCGAGGACGTCCGTTGCGTTTCAAGGTAAGCCTGCTGAACTCGCACATGTGGGATTCAGTATGTAAACG
TAAACGGAGGTTAGGGGTTGAAGTTCAGTCTGAAACCGTcgcgcttcaacatgaacgTGCTTCAGTTTTCGCACTGCAGTGCAGAGTCACCAAAgcacct
gaagaagaagatcgttgCTGCTACCTACCTCCAAGGCAACTCAACGTTGACTAAGGCGCTATTTGGCACCTGTTGTTTTCTTTCTCTCGATAGATTGTAA
TTGGCCGGTCGGTGGTCTTTTGTGCATCCGCAGCCGTgggccagctccttcacgtcAGGTCCAATGCCGAGTTCCAACGAACATGTGCTGGTCAGCCTCG
AACGCATCCTGCAGTGTTATTAGATGATGGAACACGGCGTGTGTCGTCATCTACACGACTTGCTTGCAATGTGCAATAATCTAGAACCTTGCAAATATGA
TATCCATTTTGAAAACACCATTATTTTGTCGTTGATATTCATTGTAAATCGCATCATGGCGACGCTGAGGTCGCTGAAGACGTGTtcgctcgaggagctc
aagaaagAGCCATGGCGGTTGCAGATCCAGGCGGACAACACGGCCGAGCAGCTGCGCAACctggtgctcaagaactaccacgtcttcatccagaGTAACC
AGTGCGCTGCTATCGTCAAAGATGAtgtgcgtcttcatcaccCGATATAATTATATTGCGAACTGAAATTCTCACTATTGCAATAATTAAAATTAATGCC
AGCTCgctgagctcaagaaggagaccaccaagatcgaagcCGCGATCCCAAAGCTCCAGGAATATTGTGCAGAGTTCCAGGACGAGGTAGCGGACGTTGT
CGCGAAACATGGCGATATCCAGTTTGTATTCGAGCACTATTTGCAGGTAAACAATTATTGTATTGCATTTTTGTTGATTTAATATCAATAATTATTTCAA
TTATTGTGTTGTATTTGATACAGTtaacggagctgctggagatccCTCAATTATTGGAGGCGTGCATCCACAACGAGCTGTTTGACTCTGCGCTGGATGT
GATCCAGTTTGCCAACGAAACGTTCCAGGCGGATGAGAACGCTGATGTATCGCGTAATATCGTGATTGATTGTTTGGTGCGGGAGGTGGCGGAGATGACG
ATCACCATGCGTGAAaaactgctgcagaagctgcgtgaagacCTGCAGTTAGCGCTTTGTGTTCGGGTCGTGGGGTATCTTCGACGTCTCGATGCTTTGA
TTGAAAaggacggagctgcagttgtggGGTCGATCGAGTATGAAAAACAGCTCAAGGAGGAGTTTCTTTCCTGCAGAAACGTGTGGCTGTCGTCCCTGGG
TCGAGGCATTTCGTCGTCTGACCCATATCAATATGTGCGTCCACCTTTGTTTTCATGTCGAAATATAAAAACGGCAAGTACAGTTACTGACGCTTACGGC
AATCCACATGCACAGATTGTCCAAGTCATCGACATCAAGCGAACGAGCTGGTTTGATATGATCACCCAATACTCAGCGATCTTCGGAAGCGAGGTACATC
CTTCTAAAACATATTTTTGTGCGAAGTTATCACTTTGCTAACGATTCTTGCTATGTTGTTTCATTCATGTCATCATAGAACGTAGATGGGAAGGTGGATC
CCCCACTATGCCgctgggcgacgacgacagtcGCAAACTTTATCCACATCCTCATGAAGTACGTTAATTTGTTTTTACGGATTATCGTAAAGCTTCGATC
TCAATCAACTCAAAGTATCTAACTCCTTTTTGATTTGCTGTAGGCAACTCCCGAAGATCGACGATTTCAGCTCAATCGCGACGATTCTCGAACAGAGCTT
GTTCTTTGGAGGGTCACTGGGTCGTGTTGGCGTAGACTTTCGTGCTGTTCTAGTCGTGTACTTCGAGGATCACGTGCTGAATCTGATGACAGAGTACTGG
CGCTCAGCTTGCCGCGAATTCCAGGAGAATTTGAAGGCTCACTCACTGTCAGCATCCAGTGGGTCCGCGTTTTCGGCATCCTCGAAAACACCCATCGTGA
TTGCATCATAC