Description :
From Genome Similarity Track
Location :
Scaffold_2518:1030- 4022
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2518-snap-gene-0.1Protocadherin Fat

Sequence
2992 bases(100 bases per row)
CCACGCAGACAGAAGCTCTGCAGAGATGTTGTTGAAGCCATCGGTGGGATTGCCCAGCTGTCCGCTCTCAAACATGACGCCGTTCAACAGCACAAGACAC
GCACTAAAGAGGAGCGTGGACTCGACTGTATTGTGATCCCAGAGGTATTCGACGACGTTCATGTTTTGTTTCTGCAACTGGGGCTGTCTGGGTCTAGGAG
GGACCATCGGCATATCGTTTCGTCGTCGAGCACTTCCACCACCAGGTGACCGTGTCTCTCCTCCGCTACCAGGGCCAATGTGAGCGCCGCCAGGTGTCCA
CACACCCAGTGGAGCGTTCGAGTGGCCCTCATCCACGATTCGCAAGTGCGCTGGCTGGACGAACTTCTCACCTCGGGCCTTCGCGAGCCGCGTCTCATGA
GCGACGTGCTTGGCGTAGTCGTTGACCACGTGCTGCATCTCAAAGGCGCTCATGTACGGTCGGTTTCGCACCTGGAATGCGTAGTTAACAAAGAGAACCA
TCATCACAGACGCCAACTGAAATGTCGGGTACTGGCGGAAGAGCAGACCGACCACTGCGAGCAGGAACTTGCGCAGGATGATGACCACCATCCAGTACCA
GAACTTGGGCTTGAACTGGTAGTAGATCTTAGAGAACTTCTTGCGGAACTCCCAGCAGTTGGGGTTCGTGCGGCGATTCGTTCCCCTCCGCATGGCGCGC
AGCAGCTGGTCTTCCATCACGAGCGCGCGGTTCTTCGAGAGCGTGAAGAAAACGAAGAACGGGTACCCAATGGAATACACAATGAACGAGAGCACGGCGA
ACGGGAAGAGCTTGATGTGGATGCCACCTGGCTCGAAGCAGCGCGCGTAGATGGCCACCATGTACTTGTAGCCATCGGACGGAATAGACTCGACGCAGTT
GAACACCTCAAGCGACGTCCGCGTCAAGTACAGAAACAGATAATACATCATCACGAGCGTCGAGCCGAAGAGCTGCGGCTTGTGCGACGTCAATCGTGTC
GTGCGTCGCAAGACCACGCGCTTGTAGAGGTAACGCACAACGAAGAGCGTCAGCGACACGGTCGTGAGAACCAGCGGGAAGACCTCAATCATCGTCCACT
TGTTGAAATACGACACCTGCAGGTTGAAACACTCAGGGGCGATGAGCTCCAGGTTCAGGTTGAAGGCCGACATGGTGGAGAAGACTGAAAGAATGTTCTC
AGGCCACGCGATTCGGGCATTCCCAAAGATCGAGAGCGTCTGGAAGTAATCGATACCGATGGATAACAATCCCAGACTCACGCCCTTCCTTGTCAGCAGG
TAGCTGATCACCGCTCCGATGAACACGACCACGAAGATCACGATAACCGTCAGCCACTTCTGATCTGGACACACGCGGCACTCGCTATTGAGTTTGTGGA
AATTATACAAGCACTCGTTGCAGCGGACCCCCGTATAGCCTGATTCACAGCTATTGGCCCCCAGGCACGCGTAGCTGGGATCGCACGCCAGCACATAATC
TCCCTCACGCCAGTACCCAGGCTTGGCTTCAGGCTTCGCGTCGCCGCCCTTGCACGTAGCGCCAGGTGGACAATTGTCACAGTACTGACTGGTTGTCTTG
TAGAAACCATTGCTGCACTGGAACTTGAGTTCCGTCTGACTGGACGCCGACATGACGTTGCCGCCGACCGAGAGTACAATGCTCGTGAACCCGGCCTTGG
TCTTGGGAGGTGTCCACATAAGCACAGAGGCGCTCTGCCACACGACGCTGGACTCTGCTGACGCGTTAGATGATGTATTTGAAGCTGAGCTCCCGTTTGT
GAGCATCGACATCTCACTTGTATACTCGTCGGCGTCAGCCACCGCGTCACTGGTGAATAGGCGCCGAGCTGTGGTCGAGCTCGAGTCCTTGAAGGCGATG
GTGATACCTTGATTCGGAAAACAGCCAAAGTCGCTGCCTCGGATCGTGATGGCACTCCCCCCATTCGCATCAGGCTGATTGGGCATTTGCGCTGTCACCA
CTGGCTGGTTGTACGAGAACAGAAGTGCGTTGCTTGCGTAGCTCCCGACCACCACGAGCACTGAGAGACTCGCGCCGAATCCAGGAGGGACAACCACAGT
GATTGCATAGTCAGTGTGGGAACTCAAACTCTCGCCATCCAGCTTCTCAGTCGAGAGGGCGCACAGCGTCTTTGCGGCGTCGCACTCCTTGGTGAACGCG
AACGATGGTAGAGTGACGAATGTAGAAGGATAGCAAACCGAGTTCGCCTCGTCGAAGCACGGTCCGCTGGTGTTAAACTGGCACTTGCTGGCAGGACACG
CGCGCGAGTGGCTACTACGGAAGTCCGATCTCGCTTCACGCCCACCAATTAGCACTTTGGCGTTCTCGCGACCAAAATTTATACCATACAGAACCATCTG
GTAACCTCCGCACGTCGAGAGATTGGTCGAGAGGGCGTCTAGAGCCAGGAGCTCAGGTTTCTTGTACCCGAATGCGATAGACTGGTTCATTAGAGGCTGC
TTCGAGACCTCTAGACTCACTCGTCGATCGAAACCCTGTCCAGGCGGGAGATAGAACTTGATGTTTGTGTGGCTGAAGTATACCGTGTCGTTGCTGGTGA
TGTTGATAGTCGGCAATGGGTACGTGGCCGATGTTCCGACCAGCTGAAGCGTCCAGTCCTTTGTCTTGACACCAAAGTTGTTCCCTGCCAGAGTGATTGC
GACTCGTTCGCAGCGATCCGTGTTTGCTGGACAGACAAGCGCCGCAACTGTTGTACAAGTGCCGGAGTTCACTGTCATGTAAGGTGCTGGTGTCGGAGGC
GTTGCCGTCACGTCTGTCCAACTGGATGATGGTGGGTTGTCGGTGGAAGTGGCAGCTTTATAGACTGTCATTCTAGCTTGTAACAGACTCCAGACGCCAC
TGAGGCGGGTCAGCTGAATCTGCGAGTAGAGCTCAGACAGGTATACTGGCTTGCCATTGGAGAAGACGTCTTCCACTTGAGTCACTGTGACC