Description :
From Genome Similarity Track
Location :
Scaffold_2613:1030- 2455
Sequence
1425 bases(100 bases per row)
GACTTAAACACCCACTCCAGCGTGGAGAAACGGGTGTAGACGTGAAGCGTCTTTCCCGCCAAGAGAGTGTAGCACGCTTTCAGCAATTGCAACAGCGCGA
CTACTTCTTTCTCAGCGGGATGATAGCCGAGTTCGTTCTCCTTTAGTACGCGTCCGCAGAGGCGAACTGGGTGCAGCTTGTCGTCGTGTGGTTGCATCAA
CGTACTGCTCAGCGCCCACTCATTGGCGTACAACATTATGTGGACTTCTTTCGCCGAGTCGAAATGACGCAGAATTGGAGCTTCTGCTACCCGTCTTTTG
AGCTCGGCGAATGATGCTTTTGCTGACGCCAGGTCACCCCCAGGGCCAAAGTCCGTATCCTTTAGCTGATAGAGTACTGCTCCGTAAACAGCCAAGTTCT
GGATGAATCGGCCGTAATAGTTGAGGGCACCGAGGAAAGCTTGCATCCCCTTCTTTGATTTCAGGAAGGCGAGCTCGACGATCGCGGCTATCTTCTTCGC
ATCAGCGCGTATGCCACTCGGCGTAATCTCGTGCGACAGGAAATCAACCTTGGGTTGGACAAAGATACTCTTGGTGAAGCTGATGCTAATTCGATATTCT
GTGAACCGGGCTAGTAGTCGGTCGAAGCAGGCGTTAAACGTCTTCCCTCCAAAACAGATACCATCGACAAACGACCTCCGCTTGAACACCGGAAGCAAAC
AAGCCCGGTCTGGTTCTCCATTAGCGAACATGTCGCCGTCCGGTCCGTTGACCAGGTCTTGGACCGGATCGCAGTCAGCTTGTGATTGGTGGTCAGCTTC
AAAATTCGTCAGCTGACTCTTCGTTGAATCACTGACTCCGCCGAGCTCGACTCGCCGTGTTCCCGACTCGGCTTCAGCAATAGTCATTCGTTCGGCAAAC
AACTGCCATCTTCCCTTTGGTTGAACATATCCCCATAGAGCGTTGTCGATCAGTCGCTGGTAAATCATAGGCGCATTCATCAATCCAAACGGCATTCGTA
ACCATTCAAAGTGTCCAAGTGCACAGACAAACGCTGAGATCTGCCGAGCTCGGCGTGTCATCAAGACTGCCCAGAATCCACTCGCAGCATCGAGCGAGCA
AAACCACAAGTAACTCTCCAATTCGGTAAGCAGATCATCAACTAGTGGCATAGCGTATTCCATCGGTGTCGTAACCGCATTAACCAGGTTTATAGTCAAT
GCATAGCCGAATATCCACATTATTTTGCTTGAGCACTATCACCACTGGCGAGGCCCAAGGGCTGCCCGAGAATGATATCAACCCAGCTCGAAGCAGCCCC
TTCAACAACTCGTAAAGTTTGCTCAAGTGGCGGAGAGGTATCCGCCGAGCTCTCTGCTTAATGGGTGCGTGTCCTTGAACGTCGATGTCGCACAATGCTC
CGTACGCTGGAGGCGGCAGGGCATT