Description :
From Genome Similarity Track
Location :
Scaffold_3731:1030- 2214
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3731-fgenesh-gene-0.0Protein H39E23.3, partially confirmed by transcript evidence

Sequence
1184 bases(100 bases per row)
GAGAAGCCTGCCTCGCCTGCAAAAACACCACGAGAACCGACGCAAGCGGCGACGATGAAGTCGTCAAAGTTACTGCGAGAGGAGTTCGATCCGATTGACG
CTTTGTTTGACTCCTCCGGCGAGCGCGATGTCAGCAACTTCTTTGACGTGAGTGGCGAAAAGAAATCACCAGAAACCAGTTCACGAAATATACGTGCTGA
AGGTTCTGAGGCAGAAGTCAGCAGCAAACAGGTGGAGGCAGTCAAATCGGACGATGACATCGCTCAATTCGAAGCCCCAGCCCCAGCAGCTGACGATGTC
GATTCGGATGAAGACTTCGCTGCAAGCCTGGCAAAAGCGAAGAAGAGGCGCTCTCAGCGTGGCTTTCTCGCTCCCGCAGCAATAATTTTACCTGCTGGTT
CAGCTGCTGATGTCGAGAAGCACGAGCCCAATTCTGGTGGCAACAACTCGGCGGATTCGGATGAAGAGTTCGCGCTCTCGTTAAAAAAAGGGAAAACCAG
CGCTACCACATCCTCATCGACGGACGCCAAACCGGCTGTTACAGCGGCTTTCCCAGTACAGAGCAAGCCACACGATCAGATTGACGTGAGCGAAGCTGAC
TCCGATGAAGAGTTTGCTCTGAGCCTTTCAAAGGCGAAGGCATCGCGAAGAAAAACCGTGTCGTTCTTTGATGAAGCTGAGATCAAGACTGAGTCTTCGG
AATCGACAAGTATCTTCAGCGAAGGGCTCGAGAGCGCTGATGTTGCTGAGGAGAATGTCGTGCCTGCTGGTGCTATTGCCTTCGACAGTTTTAGAAGCGC
AGAGGCATCGACGTCGCTGGTTGAATCGAGGAGAGTCGAAGAAGATGGAGATGAAGCGCTTGTCCTCGGGAGATACGCCTCCGCACCGCCGCCGCAGCAG
TACGCATCTATCGAAAACAGCGCTGATCATGAAGCGACTGAAGCTGCGGAAGATGACCAAGAGCTTCCGACTCCAGAGGCTGGAGATCTGTCGCAGCAAG
AGCTGCTCGATGAAGTTCCAATTGGCACTGACTGGCAGCTTATGCAAGAACAGGAGAAGGAGCGCAAGAAGAAGCTGCAGCTAAAACAGCGTCAAGCTCA
GCGAGACAAGCTCCTGAAGAAACAGGGCACGTCGTCGAAGCAGCTGAATGCGTCAAGCTCGCCAGCCACCAGCAACAGCGGCAC