Description :
From Genome Similarity Track
Location :
Scaffold_1695:103- 1854
Sequence
1751 bases(100 bases per row)
AAACCCAAACTGGCCCCTTGGTGATCGGCCCTTCATATCCAAACTCCCGCGATAGATCCTGCAGAAGGGATCGACGGGTTGAAGATCCAAGCAATGGAAG
TTGGATCCAGGACGGGGGACGATCCCCCAGAATCGGCCCTTAGATAACGCAGGGTCAGTGGATGAAGGATTGCAGAGGGCTAAAGCCGAGCAGCCCGGAT
CCCGCTGATCCACAAGTGGATCCAAGCTCTCCATTGGATAAAGTGCCTGGATCCCCTATCGAGAGTGGCAACACTAGTCAAACCCGAACTGTCGGGCTTA
AACTCGTTTAGAGGACCAACTGGATCCAACTGGTGGTTTCCCTGATACCAGGGTACCTGAACCCCCGAAGATAGAAGGACTGCCAGGCGAGAGAGGGCCG
CGGTGTTTGGATCCAATGGTGGATCCTACGAAGACGGAAGATGAGCAAGTCTGTTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCA
TGGCGGTAATCCCGGAGGTACCACTGACCACAGAAGAAGTCACGATTGATGATATCCAAGTGGATCCGGGGGCGAATGAACCTGCTGAAGTGGATCGTCT
GCGTCAGAAAATCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGAC
GCGAAACCTATCGCTCAGAGGGTGCGGAAGGTGGCACCTCAGTTCCGGGAAAAACTATCGGACCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTT
TCTCGACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATG
GTGTATCCGATGCCCCTAATCAACGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGTTCTCTAGACATGGCCAGTGATTTCTGGGTGGTTACTA
TGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCGTTTGGCCTGTTCGAGTGGAACCGGATGCCGTTCGGATTGAAGAACGCACCCCAGATCTA
CCAACGCCGGATCGATAACGCCCTCTATGGATTCACCCGAATACCGGAGTCCGAAACAGGTGGGTCTGGGGAAGGCCATACGGAAGTGGATCCATTCGAA
GCGGGGGAGCCAGGGGATCCTGGGACCCCCTTCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTGATCCCGGCGGAATCGTGGGATCTGTTGTGC
GAGAGAGTGACGTCCTTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATTAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGAGTACTTAGGCC
ATCGAGTTTCCAAGGAGTGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTAGCCGATTTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCTTTCTT
GGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCTGCGGTATTGTACGAATTGAGAGAGGTAGATTTTGCCGCGATGACCACT
CCAGCTGTCCAGATGAAAATCCAAGAAGCTCTGGCCCAGGAGATGCCGGATCCACGAAGGGATCCAAGTGGTAGGACGCCAGAAGAGGACCTGAAACAGG
AGCTAGACCCACCCCGGGACCAACAGAGAGAGGATCCAGGCTGGATAGAGA