Description :
From Genome Similarity Track
Location :
Scaffold_3579:103- 1580
Transcript NameFunction/comments
Phyta_totarag15369Amino Acid/Auxin Permease (AAAP) Family

Sequence
1477 bases(100 bases per row)
TTGCCCGACGTGTACGTCACGTAGCAGCCCAGAATGCAGCACACGACGACCACGGCCAGAGCGGGCATCTTCTCCCACATCGGGAtcgtgctccagcact
tcttcagcaggaACACGATGGGCAGGATGATACTGTTGAGCGAGATGCACGAGGCGCCCACAAAGTCCGACAGTTCGGAGAAGTGGTCCTTCAGCACGAT
GGAGAGGatcaccagcaacacgatGATGCCAACGCGCAGGAGCACGTActtgatggcgttggcgCCGCGGTACTCGGCAGCCTCGGCGTCCTCATCGCCG
AAGTGCGGGTTCTCGGCGTCCGCCACCGACACGTACGACATCTTGGAGCGGCGCTCGGACACGTTCACAGAGGCGTTTACGGAGACGCTCACGGCCTCCT
TGGCGGGTGTGGAGGCGTCGGCGTAGTTGATGGCGTTCTCGATGTCGCcctccttcttctggtgcatgcccagcaccacaCGCTCGGCCAGGTAGAAGGG
CGGGTTGAGCAGCACCGAGAAGGCGATGGTCACGTGCAGCTGCATGAAGAGGTAGGCGAGCACGACGGCGCCCCAGCTCGACTTGAATCCGAGCGTCGTG
AGGCCCGTGTCCGAGTCCGGGTagatggagaagagcagGTTGCCGGTGATCTGGCAGCCGACGGACGAGTAGGCTGTGCTGGCaagcacgaggaagagga
ttGAGATGAGCGaaatggtgaagaagaccacACGAGGCATGCGCTTGGGGTCgctgtgctggcgctgcagggcCGGGATAACCACACCGGCACCGTAGGC
CAGCGACAGGTTGCCGAACACGCCCGCCACctgctcgaactcgagctcgGGCGCCGGCACGGACGGGTGGCCGCGCATGCCGTACATTACGACGGCCACG
CCGATGACGTCGGCGATGATCGTGCCGAGGCAGCCGGCGAAggcggctccagctccttcctTGAGAGTTGGGATGAGGCAGACCGGCAGACACATGAGGG
CCATCAAGATGATCCAGACAGATTGACTGAAAGCGTCCGGGAAGAGTccgtcgagcagcgagccACCCAGCACGAGGAACACGCAGGGCACCAGCAGACA
CGACGCCATTTGCGAGATGACGGCGAACCAGTGGCCCCACTTGCCCGCGGCCCAGGCGCCCAGGTCGCCGTACGTGCGGACGGACTTGGGCGCGAGCAGC
ATGACGCGGCAGATGGCAACCGACGCGTAGACGTTGGCGAAAGCCATGAAGGCCATGGCGATGACAGCGAGAACGGGTCCGGCACGCGAGAAGTTGCCGG
GCATACCAAGCGTTCCAACACCgtagacgcagcagaagacgttgAAGGCTATCTTGAAGTCCTCGAGCGTCATGAGCTTGCCGCCGGCCATGGTTACGAC
GATTTTAGCGAGGTTGTCGAGGTTGACTGGCAGAAGGTGAATTAAAGAGTGAGATTGACTTAGCGGTGCGTTGGTCG