Description :
From Genome Similarity Track
Location :
Scaffold_3633:103- 1250
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3633-fgenesh-gene-0.0HECT E3 ubiquitin ligase

Sequence
1147 bases(100 bases per row)
AATCTGTCGTGAAGCCGTAGAGCTCGAGGTCCAGCGTCGCGTACAATACGTCTTCCAGCTTGACGCGGGACTCGTACAGTGGGAGGTCGAGTCGGTTGAA
GCATGCGTGGCTCGCAATGCACTGGTTGTCGTCAGCGTGCACGCCCTTGAGCGTAAACGTACATAGCCTCCCGTCATAGCTCGTCAAAGCGCTGAAACCC
GCGAGTGGGATCCGTGACGATCCGGTCGCAAAGTGCAGCAGCCGCCGACGGTACTCGTTCGGCATCTCGCGCACCAGCTCCCAGAACCATTCGAGCACCT
TGGTGCCCTTGAGGCTGCTGCTGCACTTTGTGTTCACGAGCCAGTCGTCCACATCGATCTCGTCCGAGCCGCAGAGTAGGTAGTCGAACTCTTCTGGGTC
GAAAAGCATGAGCAATTCTTGTGGGATCACCTCGTAGAGGCCCTTCAGGAAGGCAAACAGTTGACTCGACACGCTTTCGTAGAGCAAGTATCGAAACCTG
CGCTCCAGGTACTCTTCCTTGTTGGCGTCCGTCACGTCGATGCTCCGACCGTTTGGGATTAAGTCGATCGTGATGATCTGGTTCCCTCGCTTCTCCGTGA
TGCTAAAGTCCAGGCCAAGTGCGCCAACGTCAGCGTTCCCCTGAATCCACAGCAGACTCTTGTAAATCTCCGGGTCAAAGTACTCCAGGTCGTTGAGCGT
GACTGGGATCCCGAGAATGATCTTGAGCAGTGGTAGCGACAGATGAAAGCTCAGCGCATAGCCTTCCAGTAGCGCTCGCCCGACGAATCTTCCAGTTGCG
TAGTAGTACATCAAGTGGTGTTCATCGATGTCGTGGTTAGAGTTTGGATTGAAGTAGAACGTTTGCTCAGCCTTGTCAACGCAGCGCAGGATTCCATTCG
CCGGGTTGGCGATCTCTTGGCTCACGAGCACAAACCATTCCCGGTACAGTCCGCCAGCATCCACACCAGGCTCGTTCACGAACGAGATCCGCATCACTGA
CCGGATGTTGTCCCGGCGGATCGTGCTCAAGTGCTGCACCGAGTCCTCCAGCAGGATCACACGCAGAATGCCCACTTTGATTGGCGCCTTGTCGACGAGC
AGCGAGGCCGTGGTCGCAACGAAGTACGCGTACTTTGTCGGGAAATC