Description :
From Genome Similarity Track
Location :
Scaffold_2595:103- 1168
Transcript NameFunction/comments
Phypl_g15236hypothetical protein

Sequence
1065 bases(100 bases per row)
gggcgtcgagctcatcTTCATACAGTTGGGCCTCCAACAGCTGCTCGCTTGTTGAACCCGCGAAGGCACGGTTGGGACCGTGCCCAAGTCGGTGACCTCC
ATTCGCACTCGTGACATCCTCCCCGACCGAGactcggcgtcctcgccgagTGTCCGCGGCGCGGTCCGCCTGCATCCTTTCTTGtagagctcggcgctgc
gccaaCAGCCCACTCAGCGGTCGCACTGGCACTCGAGCCGTGCCATTGTTGCCATCGTCCATACACCAGTAGGCATCACTTATGCGGTCGGTCTGCTCCC
GCTCCTCCATGTCACGAAGCCAGACAGCATACCCGTCCTTGGCCATTTCCCAGGGCGTCCGTCCTCTCGAGATCGCCTCGTACCATCGTCTGCCACGACT
GGCAAGGCTCAGGACGAGCATTGTCACGCTCATAACGACAGCCTCCACACGAACTAGCACGCCCCCGTAGACCTCAAAGCCACCAGTATTCAGGAAGCAA
TAGTTGACGACCGTCACTAGCACGGTCACGCCAAACCATCCTCGACAGGCCCACTCCACGGCTTCGTAAACACCCAGCACAGAGTACAGCACCCCGTACA
CaaccagcgacgccaccgtcCAGgccgctcgtccagcgacgcaCGCTCGGCCAACCGTCCTCTGGAACTCGACCTTCAGACCTTGACAATAGAGAACGGT
TAACTGCCAACCGCGCTCTAAAGTGTTGGGCAGGAACACACACCCGTACACGTGGAAAGCGTCGATCCACTTGTGAAGGAGACGCCCCAGCCCTTCCAGG
TGCTCATGTCTAGCTTCTAGGACCACCATGGGAGTAACCCACAATGATTCGTACATCTTCCACCATCGGTCACCTCGAGGGAGTCCTTGCACGGACGGTC
CTTGGACGAAACGACGGTAGCGGCGTACGCAAATCTTCGCAAGTCCAAACCACTTGTAGAGCCGATAGCTCAGCGACGAAATCAGCCGCGTACCAACTCC
AAGTAGAGGCTGCGTGATTGCCCAGACGAGggctccaccagcagcgcagagTAGCTCGCGCCAGT