Description :
From Genome Similarity Track
Location :
Scaffold_419:10296- 13320
Sequence
3024 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGTGCCGAACGTGGTGGGGCTTTTACTAAGCGCAACACAACTTACGTTGTATGTCATCTACCGTCCCAAGAAAGAGGTGTCGGCAGCAGACACGAGTGGA
AGCGAAATCAACGCTGTGCTGGGTCTGGAAACGGGTATTTCTGAGCAAGTTGCCTTACCAAAGAGTCCAGCATTTGCTCTACTAGCGTCACCCAAGCATT
TTCTGAAGTAGAAGTCCAACATTATTCCCCCGAAGGGCGTCCTATAGGTACTACGACGAGGTGTTTCTGGACGAATGGGGATGGAAGCTGAAGCACGTAG
CCACCTGAAATTACCCCCCCCCCCCAATCCACGAAAAGATCCTTTGGTACACTTATTTGTTGAAGTTTAACCATAACAGCCGCAACAAGAGCGGGAAAGC
TGCTGCGTCATAACTTCCGTCAACTCACCACGTCCGGAACATCCTACACAGCCACACTGCTTTTTCATTACTCGTCGCAGTACCTCGTGACGCTTTAATG
CGTTCCAAAATTTTGCTCTGCGTCGTGAAGTGCCCCCACTTCTCCTCCGTGAGTCTTCTTTTTATCGTATCACAAAGAACCTTTGCAATCTTGACGTTGT
TTTTCGTAGTGGTTGCGGGATATGCGGCCCTGATTTCCATTGAGGAGCATCGAGCGACAAGGAGTTTCACAGCGTCGATGTGATTTCTGGAGACAGCACT
CCTCAACGCCTTGCTGACGCTGGATTGCTGTAACTCCACGTCCAGCAGCACCTTCACTGCATCCCGTTGGCCTTCTGCTGCAGCTTCTTCGAGCGCACGA
CCAAGGTAACCCCAGCCGCAGTTCTCATGCACGAGGACACTTAAAGTCCCGATGTCTCCTCTCACTGCGACCACTTGAATCCCGTCAGTGATCACATACG
GCTCTTGGTTATTTCCCATTCGGTTGCTGCGACACAGCCACTTCACGACATCGCTATGCCCATTCTTCGCTGCAGCGTTCAACGCAGCACTCGAGCACCT
TGTGAAGTAGTGAGCACGGAGCCACTTCACGACGTTCACATGTCCGTTCACCACAGCCTCATCCAAGGCGGCGATAGAGCATCCTTCATTGCGAACGACG
TACAGCCACTTCGCAATATCGAGTCGTCCTCGAGCCGCTGCTCCATCCATCGCATTCTTCGTCCACTTCCTAGTGGTGCCATGCACACGAACGACGTACT
GGCAATCGTTGTAGACGGCGGCGTCGATCGTCTCGGGCTTAAGGAAGTCATTGATTTGGTCAACCACGTGCGAAAGCGCTTGAACTCGCCCCGGTAGCGC
AAGGAAGACAGATGTGAGTTGCGGTTCTCTCATAGTTGGCATTTTGCACAGTGACCGTCGTCTTGGTGCCTTTGCTGGGACGTGGCGTCTTGGCACCCAC
GTTTTCTCTTTTTCGCAAGTGAGAAACGCAGTGATGGAGTCCACCGCGCGTGTATTAAGAGGTCGTCGCCTAGAATGAACAATGAAGTGAACGCACACTT
TACCGATACGTTTTTCATTTGAGTCCAGCTTCGGGTACGTCAGCTCTGGGTTTCCAACTACATGCCGGTTTGTCAGTTTTTTTATTGGGCCAGCTCAATT
TCCTCTACGTTCGCCTTTCCTTCGTTTTCACCCTCGTCTTTCGCGTCCTCCACAACCTCCTCGGCCACCTTCTCGACCTCCTCGGTAGAATCTTCTTCGA
CTTGGTCAGTCACGATTTCCTCGTCCTTTTCCTGCTCTTGCTCTTCCTTCTGTTCTTGTTCATCGACTTGCTCGCTTTCCTCAGACGCTACCTCCTGAGA
GGTTTCTTGGGGTTCAGCTACAGG