Description :
From Genome Similarity Track
Location :
Scaffold_145:10296- 12445
Sequence
2149 bases(100 bases per row)
CGTCAGTGTAGTTTGGGCGAACGAGTTGGCGGGTATGCATACTCACACCCGGACAGGATACTCCGGCGCGAACACAAGATGCAACAACATGGCAGCACAG
CGCGTGCTTCCGACTATAGGCGCATGAGCAAGACTTGCTTCGTGTGTCTACAATCCAGCCACCAGACGGCATATTTTCCGTTTGCATCCGCCGTGAGTTC
ACAGATCGGATAGAGTTCGCTACCAACTTTTTCTCCACAGCTGTTAGACGTAGCGGCTTCTGTTTCACCCTGTAAAGATCAGCGGCAACAGTTCCAACAG
GTGGGATCCGATACACCGAAAGGCATCCCCGTCTGTGCATGAGTCGGTACATAGCCATCAAACGTTCGGATGCGGTGGCCGCAGTGGAGAATGTGGCGTC
ACTGTTGAGAGAGGCGAGTCGAGCGCCATTCAAATTCTTGAGTAGCTCGCTAGGGGTTGCCTCCCCAGGGGGACACTGCAACTTCATGGTTCTGTGATAT
TACTCCAAAGGGTTATTCATTGCGGCGTAGCCACTAGGTGTGTAGAAAGCTTGCCAACGGGAAAAGCGATGCGAGTTTGTCTACATTTTTTTACACGGTC
AGTAAGTTTGCAAACAGCTGATCCACGTTCGTATCCCCTCCATTTCGTGAGAACGCGCTCTTTGACTACAGGAAAGTCTTCCTCATTTGCGACGTGCATG
TCATACAAGTCCGCAAATACAGACCTAGTGTCTTCGGCACTCACACGTTTCTCTATAGCATGTTTCCATACATTTTGCGTCACGTGAAGCCAGCACATGA
GCACAGCTGTGTGCGGTAATTCCGTGATACAAGTGTTGAACTGAGCTTTGTCCGCATCCATCATGACAAAGCCAGGATCGAATCGGACGTCACACACTTC
CAAACACACGCGCTATACAAACCGGATACACCACCCGATATCAATTGCACGTTTTTGCGATGTGCAAAAGTACACAATGGGGGAAAAGTGGCCAGCCCGA
TCCGAATATCCGAACGCGAAAACCACGTAGCCGTTGATGGCCATACTGTCCGTCTGTCGATGTGAAAGATCGTCGTGCAGTCGCCACGAATTTGAACAGC
GATGTACTCTTTAATGAGGCGTAGACAGGTCATTCCGACTCTTAGCGGATACGATTTGGAGCCATCGCCAAGCTGGGAGACCACACCAGTTTCCCTGGGT
GCGGAGGCCTGCTGAGAATCGCACAGAATCACCATTTCGGTGTCCGGTAGCTGCTCCAAATTGTGTTGGTCGTAGAGGTGGCCATCACATATGGTGCCAT
GCTGTTCTTGGGGGTTTTGCGCCGCCAATTCTTCACAAAGTCGGTAACTTGGCTCTTTTTTGGGGCCGGACCTGCTATTTCCCCATCATCTACGAGCATG
CCAATAAGTGTGTAGAGCCTTGCCGCCGTAGTTTTTTCTCCAGACCCCAAACACTCTACAATATAGTCCTTCATTTGCTTGGTCAACTTGCGCTCCACAG
GGGTTGGAGGGTCGTTTATGTTCATCACGTGGTTGTATTGCTGAAACACCTCGCGTGTACTTGAAGCGAGGCAGAGCTTGAACTTGTATCGACACGGACA
GGGAGGTGGACGTCCTGCGCTGTCACCATGCACACGTTTTTGTTCTGCCTTGCAGCGCTTCGAGCGACACGGTACCAATTGAGACCGCATCGGATGATCC
CGCCGATGTAGACTGTAGTCACGATCACTTAAATGGTTGATAGTACAGTTGACTTGATTGCTTTTATCTACTGCATGCGTCGGTAGCTCGTCGCGGAACA
CCGCCAGTGTGTCCGGCTCCGTTGAACGCCATTTCTGATTCCATGGCACTCTCTGACTTGGCTCTGCGTCGTCGTCCAGACCGAAATCCCACTCATCCAG
CTGTAGCCGGTCATCGGAATTGTCGGTGGAGGCGTTGTCGCCTCTATTAATCTTCCTTCTACTTCACTTTTGAACTGAGAATGGCTAAATAAGCATAGGT
TTCAATTATAGGCGCTGCAGCTCAGCACGTTGAAGTTAAATATCTATTTCGGTGATCATACCAGTTCTCCTGGTGGTCGTACACTTTAAGATTGGTGGTC
GCACCTTTTTGTATGGGTGGTCCTGTCCATGTTTTGGGTGGTACTACAC