Description :
From Genome Similarity Track
Location :
Scaffold_430:10293- 17619
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_430-fgenesh-gene-0.2ATP-dependent protease hslV
Pytar_ATCC12531maker-par_contig_430-fgenesh-gene-0.5CAMP-dependent protein kinase regulatory subunit
Pytar_ATCC12531maker-par_contig_430-fgenesh-gene-0.3RRNA-processing protein EFG1
Pytar_ATCC12531snap-par_contig_430-abinit-gene-0.38Protein kinase

Sequence
7326 bases(100 bases per row)
GAAGATGCTCGCTCGCTCGCTGCTGCGCTCCAGCGCCGCTGCCGCCTCCAGGGCCACCACTACTCAGACGTCCGCCATTGCCAGCCATGCGCTTCTCGGT
GGACTTGCCCGCTTCAGCAGCGCACCAACGGTGCGGTTCTCAATCTCTACAGCTGAGTGGAACCGGCAATCGTTTTTCGATACTAATCTCTGGTGGTTCA
CTATGGAACGCGTAGATGCACGGCACGACCATTCTCTGCGTGCGCAAGGAAGGCAAGGTGTGCGTGATCGGCGACGGCCAAGTGTCGCTTGGCCACACGG
TCGTCAAGCCGAACGCCAAGAAGGTCCGCCGCATCAACGACAACATTGTCGCGGGCTTTGCCGGTTCCACGGCCGACGCATTCACGCTCATGGAGCGTCT
CGAGAGCAAGCTGGAAGAGTACCCGGGCCAGCTCACGCGCGCGTGCGTGGAGCTTGCCAAGGCGTGGCGGACAGACAAGTACCTGCGCCACCTCGAGGCA
ATCCTCATTGTGTCGGACAGCAAGCAGTCGTACACGCTCACGGGCAATGGCGACGTCGTCGAGCCGCATGACGGCATCATTGGCATTGGCTCGGGTGGCA
CGTTTGCGCTTGGTGAGTACTTGGTTGCGTTTTAATCTCTCGGTATCTACAGCGCTGACCGTGGTCTGTGTGCTCCTGGGATTAGCTGCTGCGCGTGCGC
TCATCGACCAGCCCAACATGGATGCCGAGCAGATTGGCCGCAAGGCCATGCAGATCGCCGCCGACATTTGTGTCTACACGAACCACAACTTTGTGTGCGA
GATGATCGAGGACAAGGCCGAGATTGAGAAGAAGGATTAAGCAACCAAATCGAACGGACTCCATCCAATGGGACAGGTGACACGAAGTGGAGATGCACGA
GAGATAGATAGATCGTGTGATCGTGTGTTTTTCGTGTGTGCTATTCCATACAAGTCCAAAGGAGGAAAGAAAAAATAGGAAGCAACGTCTTCTCAAACAT
TCCTGTGTGTGGGCATGAGTCGCAGTCTTCTCCTTCGTGTCCTTCTCACCAGTGGCGACCTCTAATTTGCTTTTGCGTCCAATAAAAAAAGATAAAAAAA
GTATCGCCCAATCTTTCGTCGCGATGACTGTCTGGCATCCATCGACCACACGCGTCTTTGAGAAACTGGTCGAGTGAGAGCGAGGGGTCCAGCCTAGATG
TTGTTGGCGATGACGGTGTTGTACTTGTCGATGTTTCGCTTGAGGATGTCTTCTAATGGACCCATGACGCGCTTGAAGGTCTTTCGGTCCAGCGTGAGGC
ACTTGACCGTATTCTTGGCGACCACGGTGGCCTGGCGCGGTCGCGTTGTCAGCAGCGCGATCTCGCCAAAGTAGGCACCGACCGTGAGATCGCCCATGAT
CACGGGCGGCTCGTCCGGGCTCAGCTGCTTGGAGCACGTCGCGACGCCTTCTTCGATGATGTAGAACATGTTGCCTTCGTCGCCCTGCGTGATGATGACC
TCCCCATCGGCAAATGTCTCCGACTTCAACGCATCCGCGACCGTCAACCGCTCGTACTCGCTGAGTGACTCGAGCAAAGGCACCCGCTCGATGAAGCCCT
TGTGGGCCTCGCGCTTTTTCAGCGTCGTCTCCATGATAATGTACTTGAACGTCTGGCGATCGAGCGCCCACGCCTTGGACTTTTCCACAGCCTTGACGGT
GGCCGCTCGGGGGGCATTGTACATGAGCGCGAGCTCGCCAAAGNNNNNNNNNNATGGACGTCGTGCACTATTCATATTGAGATCAGACTCCCCACCGACA
CGAAAGAAGCACCACTGCACGCACCGTTTGGACCAGCACGTCGTCCTTGTAGACCTCGCAGACACCGCTCTCCAGAATGTAGAAGTTGTCGCCGTCGTCG
CCCTGCTTGATGATGATGTCGCCGGGCTCAAAGTCCTTGGGGAAGATCGCGTCGAGAACGATCTGGAGCTGCTTGTCGTCGAGCGACTTGAACAGAATGT
TCTCGGCGACCATGCGCGTAATCTGCTCGCGCTCACTGTCCGACTTGGGGTGCACCACACGCTCAAACGTTTTGGCACTGTTTTGGCAGTTGGTTAGGCC
CCAGTGGTTAGATCTCCGCGCCAGTGGTTAGCTCTCCATGAAAACAGCTAATACGGGAGGCGCACCTCGACGGGTCAATGGTTTCTGCCGACACGGACGT
TCTTCGCCCTTTCACAATGGGCCTGGGCGGCTCGGGCTTGTCGCGGATCTCACCTACCGCGTCGCCGCCTTCATCTTCATCTTCGCTCTCGGACTCGTCC
GAGTGGTGGTCTAACCGCATGATCATGGTTAGTTCTGAAAGAGAAAAAAAAGAAAAAGAAAACGGAACGCCGTCGTAACCCGTACTCGTATGCGGATGGT
GGTTCGATGCTGCTGGGTCGACATCCTTCGGTGTGTTGGGGTGCGAGAACGATTTCTTCTTGGGCAGCGCCTGCTCCGGGTAGTTGGATTGCAGGTATTG
GATAATGTGGCTGATCGGGTTCTCCGGCTTGGCCAGCAGAAGCGACTCCACGAGGTTGATAAAGAGCGTGTTGATGCCCTTCTTCTGCAAATAGTCCTGC
AGTTCCTGCTGCACTCCTTCGGCGTCCGCCATGGCTGTTGCTCCCGGTTTACCGTCCGGTCTATCGCTTCTCTATCAAATGCCAACGATCGATCGGGCGT
CCGATGCCGTTTTGGCTTCTGGTATGTGCGCGTGGAAGCAGGTCGATGGAAAACAATCCGAAAGAAGCAGCGAGCAGTTCAGAGCACCGCTAGTGATTGG
AGATAGGACGCTCGAGGAGCTTCTCTCCGCGCCCCCTGCAGTTACGCGGATTTTCGCCGGCCTCTTCGTTCTTTCCTTTCAACGCCGTTTCCGCATTTTT
TTATTACGGGAATCTTCCCAGATCTCATTCGAAACCGTCTCCTCAAAACGCATAATCTGTCTTTTCGGGTTGATCGAGTTGTTCCTAATTGGTTCTGGTC
TCAAGGAACACTCCCGCTCGTGCAATATATTTCCGAAATGTTCTAAACTTTCCAAAAATAGAGCTGGATCACTTTCGCAGCAAATGGAAAGAATGCTCTT
TTGGTTCAAGAGCACCTTACCTACCCTTTTACAAGACTACTCAAAGAGCCATTTGGTGTGGACAACGTAATCCTGGCCGCCAGCCAATCCAGCACCAGCA
AGAGTGAAAAGCAAGTTGCTGGATCATGGCGCCGACCGCCGGTGCGTTCGCGCGGCGCTCGCCGCTCCGCTCATGCGCTGGGGCTCATGGCATAATGCAC
TGATATAGGTACTCGACTGCGCTTCAAGAAGACTGCCGCAAAAGCGCACGGTAAGCACCACAAGAAGGTGCCTTCTCTCAAGAACCGCATCCGCGCGCTC
GAGCGGTTCCTCAAGCGAGGCGGAGTACGTGGTGGTTGATAGCGACAATGAGCCGTGCGCAACGCCCGTACTGACTAGAGTGGGTGTATGGCTGTAGAGC
ATCGATGAGCAGACCCGCGCGGCCAAGACGCGGGAGCTCGAGCAGTTGCAGCACGAGGTACGACGCCAACCAGTTTTGTATGCTTGTGGTTTGCTGACCC
GACGGGCGTTGCACGCTTCCACAGCGAGACGCAAAGGGCCGAGTTGAAGAGGAGAAGAAGAACGCTGAAAAGTACAAGAAGGTGAGCATCTGCGCCTCCT
ATTGATGGGGTCTCCAACGGTTGCAGAGGCTGATCAACATGCTTTCTTTTCCATTGCCCAGCCGCGATTCTTTGAGCGTGTCAAGCTCATGCGCAAGCTG
AAGAAAGCGGCAGCTCAGATCGAGTCGGCCGCCAGCAAGAAAGAAAAGAAAGAGTTCGAAAAGGAGCACGAGCGAGTCCGTCACGACCTCATGTACATCT
ACTACTACCCAAAGGCCGACCAGTACCTGTCACTGTTCCCGGCCAAGCCCCACTCGGACGAGAACCTCAAGAGGTATGCCTGACTGGTCTGCCCGGTTTT
TGTCACAATGGGGAGACAGCATCTCATAATGCATTCCTGTGTATATGTACCAACAGACAAGAGGCGCTGCGTGAGGCGGCAGTCGCTCGTTTCGAAGAGG
AGCAGCCGCTCGACGCGTTCCACAAGTTCTGCTATGCAGACGGCCACGCTGCGCCGGCGGCCAATGCGGCGGCGGTGCTCCAGGTGAAGAAGCCGACAAA
AGAAGAAGAAAAGAAGAAGCAAAAGAAAAAGCACAAGAAGGAGAGGAAAGACGGCGACGACACGGACGAGCCCAGTAAAAAGAAGCAGAAGAAGAAGGAA
TCGTCGCGGGTGCTGGCCGATGCCGACGACGAGGAGATCGAAGCCGCGCAAAGCAAGAAGAGTGACGGAGACGACGACGAAGAAGAAGACGATTTCTTCT
TGTGATCCACTCACATCTCTCCGTTTCTCCACGACAGACTGATAGATTTCATGTGTAAGCGAACCATTCAAAATGCAGATTCAAACAAACAAAGAAGATG
CGACAGAAGAGCGAATATGTCCTTGTTGTTAGCGTGGGGTTGGTCAAATGAGAATGGTCACGGAAGACGAGTTCTCCACTTCGCTTAGCCGCGTGTCCGC
GATCAGCTCGGCTTCGTTTCGAGATGCCGCCGCGAGCGCGTTCATGTTCGTAAAGCTAAACGACCGGAAGGCTTCGTTCATTTCGGCCTCGTCACGCGGA
CCGCTGTACATGCCGCTCGGAAACTTTAAATTGTTTTCGACACGATCAGTGTCGACGGTCGAGGCCGGTTCACTCGTAGCGAACGTTAAGTCTTGGTCAA
TCTTGAAACTGGAGTCTCTCGCGATCTTGCTATCCAACGCCGTCGTACGTACCGATGGCTGCGCCCCGACCAATGCGCCCAAGGCGTTCATCAGCTGCTC
GTCTTCTTCAGTGGACGACGGAATCCCCCCAGCGCTGGTACTGGTTGCATCCTCGAGGGCACTCGACTCGGATTGCTGTTCCACCATGCTGCTGTCCACC
GACTGCGTGTCAAAGTCGAATTCTTCGTCGTCAATGAAGATGTCGGTGAGGTTCCGATTGTTGAAGTAGCTCGTGTCGTTTGGCCCTTCGAGCGTCGGTA
CAAATGGCGGAGTCGAGTCGAGCAGTGTGTCCCAATCAATGCCTCGGAAGAACGCGTGCCTCTGAATGCCCTCCCACCCAAGTCGCTTTGACGGATCTGG
CTCGAGTAGCAGATTGATCAAATCCATGGCCTCGCTCGATAGACACTTATCGCCGTCTGGCCACAGAATCTGTCGCTCGAGGATGTTATTGAAGATTGCC
TCGACTGTCTCGTCGTTGAATGGCGGAAAGCCCACGAGCATCTCGTACAAGATCACACCCAGCGCCCAGAAGTCGACAGGCGGCCCATGTGGCTCGTTGA
GAATGATCTCTGGGCTCAGATAATCTGGTGTGCCACAGCGACCGTACGTGTGGGAGTACGCACGCTTCTTCTTCGTGTGGCGCTTTGGGCGAGTCGAGTT
CAGCAGATCCAAGTTGAAGTCATCGCCAAAGTCGAGATCTTCCGGGGAGTGTATCCGATGTTGAGATGAAGGGTCGGCAGCGCCCGACACACCGCTAGCA
TCTGCGGAGGTTCCTTCGTGACCTCCCAGAAATCCCTCTCCGTCCGGAAGTTCCGATTCCGAGTCGCTGATACTCACACCCTCTTCCGATAGACCAAAAT
CTGTCAGCTATGCGAGTTCACAGACGACACAGGTGAGTCGGCAGTTAACGACAAGCCAGATGCCGTAGCAGGGAATCTACGGCACCTTGATGTGACCACT
CGATGATATCAGAATGTTGTCCGGCTTGAGGTCTCTGAAAATGTTTCATCAAAAGGTCGTCGTGTCAGTATGCGTTTGCACTAGATAGGCCCTCTTCATT
GAACGTACCGGTGAACACTTCCCTTCATGTGAAGGTGGTTGAGCGCGAGCGCAACTTCCGCGATGTACACGCGGGCAACCTAATCACGAACGCCACCATC
AGTGCATAACGCATACAAATGCCTGGGCTCGCGGCCGTACCTGTTCTTCGAGCTGAACAATGCATTCCAGAAGTGACATGAAATCGCCGCCAGGCAAATA
TTCCATCACAAGGAAAAGGTTCCTCCTGCACAGCCACGAAGAATACCGTGAGTATATGGCACTCGTTCAAGCTTGATGTCAATCCAACGCACTTTGTCTG
GAAGGTCCAAAAGAGCTTCACGACGAACGGGCTCTCGACGCTTACAAGGATGTCGCGCTCCGTCTCAATGTGCTGGATCTGTTCAGTCAGGCGTGTTCAA
CATCAGTATGCAACGCGTAAGAGAAAGAAGATAATCTACCACCCACGTACCTGCTTTTTGCGCACCACATGCTCTTTCGCAAGCACCTTGATAGCGTACT
GGTCTCCGGTCGTTCTCTTCCGCGCAAGATAGACCTTGCCAAACGCACCCTTGGAGATCGGCTTGACAATCTGAAAATCTCGAATGGTCACGCGACACGC
GCTCGGGCGACGAATGCCGGAGAGTGGTGGAGCTACTGACGCGCGAGAGGCTCCGTTCTCCAACTCTTCGAGCGACTTGGTTCGCTGGAACGGTGCGCGT
CCTTCATTCGGCGCTTGCTGTAAGAGCACTTTTTGGGTCTGCCGCATCTTGCTCATCTTGGCATGCACGAGGTTCCGAATGCGGTGGCAATACTTCAGGC
CTCGCTCGACGGCAAAGTTGGACGACGCGAGTGGCTCTTGCATGCGGATGCGATCGAGAATCTTTATCAAGCGCGAGCATAGCGCAAAGGACTCGACCTG
AGAAATGTCGCACGACGAGGCCTGGATCGCAATCACGCGGAGCGCATTATAAAAATGGAGCGCCTCGGGATGGAAGTGCGCGCGCATCGCGTCCACGGCG
AGGTTCGTCTGCACCGAGGTCGCGAGTCGCGCCAGGGCATTGTTGATCTGGTCGGCCTCCAGCTCGAACCGTCTCGACATGACACAGTAGTTGGTGTGCT
CATACAGACTCCACGCGTCGATGCGGGACTCGCAGAGCTTACATAGCACCATGGACGTTTCACATCGACGGAACCGCACCGTCAACGGTCGCTGAGAATG
CTGGAGCAGGTCGATCACTTGCTCGGGCAGTAGCGACGCGACGTCGCGGCCATTGATGGCGTCCACAATCAGCCCAGGCGTGATGACCGCACCGAGAGGG
ATCTGCAAGACGGTCTTGCTCCACGCGTCCTCGTGCACACTCTTGACCATGACTTGCCGCCTCGTATCGTTGATGGCAAACTCGATCCCGAGAAAGCCGT
CGCCAAACTTGGCTTCGAATGTATCA