Description :
From Genome Similarity Track
Location :
Scaffold_58:102912- 104910
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16519hypothetical protein
Phypa_INRA-310PPTG_16520transmembrane protein

Sequence
1998 bases(100 bases per row)
GCAGACAACGTCGCCGCAAAGTCGGCAGTGATGCCGTCGCCGATACATGAAATGGAACTTGCGACTGCAGATACTGCAGGAAGGGCGGTTCTCATCGGGG
ACCCAATTCTTGTGTAGAGCCAGTGTCTGCTTTGCAATGTTCTGGGAATCGATCACGAGTGAGATATCGTTGAGGACAGCCATGTTAAAGCGGTACTGCG
CGTGTGCAATAATTGACGATTCGTTCGTCTCACTGGCCCCCATAACGAAGACTTCGGAGGTCCCCTTCGGGGTGTCCGCGGACGGTGCGACGAGCATCGT
GCGCTTCATCCGCACACGCGTTAGCTTCATAGATCCCGTCAGTTCTGGGCATTCGGGTACATCGACCGAAGCCATCGCCACAAACCCGATCTCCTGTCCG
GTTGTATTGGTGGTGTAGCCCACCATCTCCACGAAGCAAACATCGCGCTTGCCAGTGAATGAGTTCTCAGCTAACCACTTGATGCCCAGATAACTGTCCT
TCGTCGCGCGGATGGTGTGTAAAACAGCACCATCGATCACTACAGGGGACAGTAATCTTTGTTGCCGCACGAAGTCGACGGAGTTAGAAGCGTAGTGCGC
GTCCACAATGTCGCGATAGTTGCCTTGGACGCGCCCGAACGTTCGGAAGGACTGTAGCGGTGGCCGGGGGTCAAGCGGATCGCGACGTCCAAGCGTGGCT
CCAACAGTGCGACGGGAGAACGATAGCCGTCGGTGACGACTTTGAACGCTGCTTCGACTGCGAATGGCCCAGGTGTGCGGCCAACTGCTGCTGATACGGT
CGTTCACGTTGCATGCGGTGGCTCGGTTGCTTCGATTCAGTGTTGTTGCCCAGGAAGAGGTTGAGCAAAACGAGTCCGTTCCACGAACCCTGAACGTCTT
GAGCTGGCCGAGAGAATTTACGAAGCGCCATTCAGAGTCCAGGTTGTTGTCCTTGGAGAGCTGAACGGTGCGGGCGAGGACAGCGTCCTGCACCTGTTGC
TTCATCATCGACTCGAGTCGTTCTGCTTGGGAGCGTGAAAGCGACACCGACGCGAACATCGTTGGTGTGGGCATCACCATTTGTACAAAATACTTTGCTG
CTCGTTGCACCGAGCGCGAAAGTTAAGAAATGGACGAATGGAATCAGCAACATGCTTCCAGGAGCGCCGCTAATGGTGTGACTGCTGTTTGGTCTGCGAC
AGCGCATTTCACCCGGAGAGATCGAACTGCCTGCCACAGCTCTGTTGTAGACACATGGTAGGACGAGTGGTGTTACTGAAGCAAACAGGATTATTTGAGT
GTTGATGTGCCAGCCCAGCTTGCTTGGACCATCCGGTATCACTTACTGTACGCCTACAACCCATTCGACCAATGCGGATACCTTTCTGAAAACGCGATCG
AGACTGGTCTGAATCTCGACATATGGGAAAATGTAAGCAATCAACTTTGTGGATACTTTGCTACTTTAAAAAAAGGTAGTCTCCAGGCTGTCCATCGACG
GAAGGCTCAGTTAAGGCCGTGAAGTGGAATGAAGCTTGTGGCAACGATATAAAATGCATTATTAAAGTGTAGATTGCTGCATCATCTCAAAATTCGTTGC
CATCACGCTGCGTGATTGCAGTGAACTGTGCGATGGTGTCGTGATTCACGCTGAACACAATTGATGAAAACCTTATCACGGCGCACTACGAGTTCTCACG
TGTTCTACATCGTTAAAAATAGGATGTTCCCGGAAACATGGATTGGCAGCGAATAGTTTCTGCTTCTATTTTTCTTGGTGGCATCTTATGGGCGAGTGGG
AGGGCTCAATGTTACCAACTGGCTTCAGTCTGAATGCTTCAGCTTGAATATCTACCCACAAGCTGATCCAAGATCATCGCGCTCCTATTGCTTGCTTTGC
TCTCCAGATTGCGCCCGTTGAAGATCGAGACTGCTTTACAGTACCCTTCGTCCTTTCGAGCGTTCGCGGGCGCTAACAAGACCAATAAAAGCGATCGC