Description :
From Genome Similarity Track
Location :
Scaffold_72:1029- 6997
Sequence
5968 bases(100 bases per row)
CTCTCAGAGAGAGATACTTAACGCCAGAAACTACGACGATCTCCGAGTGTTAGGCCAAGTTGGCGGAACAAGCACGTGGTGCAGTCCTCCCGATTGTTCT
GTACCCAGGCGAGCGTGAGGCCGAAGATGACAGCACGTTGACTCGCTGGGCTCATATAGCACGTCGATTGCCCAGCATAAACGACCTTCGAGCTAGCGCC
TCCAAGGACGACGTTCGTTTAGAGCTCAAACTGCGTTATGAATTGGCTAAGCTGAAGGCCAAAGGCCAAATACATTCACTAATCGTACTCTGTAAGCAAA
ACCAGTTACTGGTCAAACATCCACTGTTTTAACTGTGCAGACAGTCGCGGGTCACTCCGTATTGGTGAGAGAACCGTACATCTCCACACCGATTGTTAGG
AAGAGCGTTGGGATGCAAGCTGCCTCTCAGTGCGACGCCCGAAATGTCAACGGCGTACGAGCAATCTTACTGAAGGGGTACCTCAACCCCCCATGATTTC
TAAGACTCAGGGTATCCACGCCACTTCACCAGGTACTGTTATTGACCTTTGTGACGACACCACTTCAGAAATCTCTCCACATGGAACTAAAGTTCCCTTG
CTCTTCAAGCAACGCAGGAGGAGGTTGGTATGTCGGTACAGTCTTACGAAGACTTGGTATCAGAGGTGACGCAACTCCGCGAGTCTTTCGATCACGTGCC
GACTGCACTGAATCAGTCTGTAACTGAGAGGAAACAACTCCGGGAGATTCTTGATCAAGTGCAGCGCGATCGTGAACAGTCATCGACTGAGTTGACTAAG
TTGCGTGATCAGATGAACCGTCTCGGCTCGATCTATTCGGTCGACAAATGACTGCGGAAGGTGGAGTACAGCCTGCCTCGACTGGATGGACAGAAGGAGC
TCTAGACGAAGATGCATTTATCGGGGACGACTTCCTACCCTCAGGCGCAAGCGCCTTCAGGTTTAAGAGAGAAGATCATGATATGGCTTAAGCAAGCCAA
CGTAAAACACTGGGTGTGTGCAACTTGCGCGGGAGATTGAGTGTATAGACAAGGCCTTTCTCATTAATGACCGTGAACGGATCAATGAAGCGTGGACACA
ATTTTGTCTTGAAGACGGCAGACACTACATTTGTAGGTAGGTTCTTAGCATTTGTTAAGACTTGGTCTCCAACTTCATAAGAATCAATACATCCTCTGCC
CTTAGCATCAGCTTGTTCTTTTTGTTTATCTTGGCTATCAGCCATTGCATCATGCACATGTCGTAAGACACTAAAGCGTGTCGCGAGAAACTCGCTTACT
TGTTTCTACATCGTGGTAGAGCTGATATTAGCAAGCTTTTTGGCAGACACTCCCCGACCAAACCCAGAACCACGTAGAGGTAACAAGAGCGGAACGCAGG
GGTGCGTGAGGCTATTCACATAGAAGGGAGTAAAGCCGGTCGAGGCATGAACGGCGTTGTTCAACGCAAACTCAATGGCAGGGAGCATCGAACTCCAAGT
CTTAGGCGACTCAGCACAAACACTGCGAAGAACGTTGCCAATGACGCGATTAATACGCTCTATTTGACCATCGGTCTGCGGATGATACGCTGTGGACATG
TCCAATCGCGTGCCAAGCACCTTGAACATGGAAGTACTAGACTTTTCGGTGAAGCGAGGGTCGCGATCAGAGATGATTGCTAGCGGCAACCCGTGTTCAC
GAAACACACGATCTACAAAGAGCATATTTATACTTTTACCATCGATGGAGTCCGGCACAGCCGCTAAGTGATCCATTTTGCTTAAACGGTCAACGAAGAC
CACAATCCCCGTATTGCCGTCACAGTCTTTGGGAAGACCAAACACAAAATCCTTGCTGATGGAATACTATCACCCCGTGGGCACAAGCAAACTAGCGAGC
GGCGCAGCCGACGTACCGAGTGTTTCACCCGCTGGCACGTTTCGCATGTACGCACGTATGTGCTCACCCATTTGTATAGTTTCGGCCACCAGTAGGGTTG
ACTCACAGAGCCATAAGTCCTTCCCCGCCCAAATGCTCACTGAGGGCAGTATCGTGGGCCTCAAAGAGGATTCTATACTTTAAATCCTCATCGTGAGTTA
CAGCAATGCGAGCGGTATCCGCTACATCTGTGCGATAGCACAAGAGACCATTACCTATGGAATATCGATGTAGGCTGTCCCGCAAGCGTGCCGATAATTG
ACTGTCCGAGTCCTTGTATTCCTCACTCCCAAGGGCACGAAACAATACCACACACTGAGAATCCCGTAAATATGCCACACGAATTAACTCCTCAATAGGA
TACAACAAAGTCGTGACATGAGCAAGATCATAATCAGGTCTGCGAGATAGGGCATCTGCTAACACATTTTGTTTGCTTGGCTTATACTTCACCTCGAAGT
TATATTCCGCAAAGAATGAAAGCCACCGAGCCATTCTCTGAGAGAGGTGAGGCGAATGTGGCGCCGTGCGTAATGACGCATGATCCGTATAGACGACGAA
TGGATTGGAGCCAAGCATATGGACTCTAAATTTGACGAGTGCATACTTCATAGCAAGTAACGCTTTGTCATGAAATGGATAGTTCGTTTTAGCAGCTATC
AGCTGACGAGATTCAAATGCGATAATTCGGTCGAGGCCCGCAGCATTTGTTTGTAACAGAACGCTGCCTATGTCAAAGTCGGACGCATCGGAGACAACAC
TAAAAGGGTACTCAGAATTTGGCAATGCCAAAATGGGAGCATGGAGGAGACTTTCCTTTATTGCCCGAAATGCGTCAGCAAAGGTGTTTCCCCAGCGCCA
ATCTGTGTACTTTTTAAGGACATCAGTTAATGGCCGAGTCACATCGGCGTAATTTTCACTATATCTGTATAAGTAACTGGCAAGGCCTGACCACTTACGC
AAGTCTTTTTGATTCTTAGGAAATCGGCTAGACCACTATAGCCTTGACATTAGCGGGATCCGCTCTAAGGCCGCGCTTACCAATGAAACAGCCGAGAAAA
GAAATTTCTTCTGCACCAAAAATGCATCTAGACGCGTTGGCGTACAATCTATTAGTCCGCATGCACTCGAGCACAGCTCGCAAATGATCGATGTGATTGT
CAACACCTGACCGACCTTGTTCGGCAAGATTATGGACAAAAATGTCATCAAAGTACGTCTGTAGATAATCGCGATGTGGGCGTAAAAGTTGCGTCACCAG
ACGATTAAATGTTGCCGGTGCATTAGACAGCCCTTAGGGAATCACCAGCCATTCCCATAGCATACCACTCGGGGTGCTCACTGCTGTAAGCGGAATATCA
CTCGCTCGCATGAGCAATTGATACTATCCATCAGTCAGTCGAGTGCGCTATACATAGTACAACTAACCATGTTGTTTTAAACAACGTCCTTCCGAGTAAT
GGGCGTCTTTGCCAGAAGAGTGGCCACATTAAGCTTGTTATAAGCATGTACAATACTCCACTTGCCGCTCGGCTTTTTGACACAAAATGTCGGTATCGAA
TGTGGAGATTTGCTCTCACGTACCCTTTCTGCCTCGTGCGTGGTACGGAAGAATTCATCAATGACATCACAATGCTCCTTAGGCACGGGGCACTGTTGTG
TGACACAGTATTAAGTCCCAGGAACGAAGTCAATTCATGACGGACACCTCTATCTGAAGGTAAAACAGAGGGTGGGTCGTGACACACCACATCTTGAAAT
TCCTTTACCAAAAGAGATATGAGTTTTTTTCAATATTAATGACCCACTACGCGGATCGAGTGCCGCTTTTGTGTCCTTCAGAACGGCTTCATCCAAAAGT
GAAGAAGAGTTCAACTCTATGGTGTCGGATCGAATGACCACATCATCGAACGTAATTTTCTCTAAACTAGAGCTGACGTCACTATTCACAGCCGATGACG
ATTCATTGGACATGACATCGTCATCACGTGGATTACGTGCCACTTCATGTGCATCCGCTGAGCCGGGCTCGGGATGCCTTGGTATTTCACCAACAACGTC
AATATTGACATTCTGCGCGTCGCTATCATAGCCTACGTCACTCAGTGGGTACTTATGTGCCACCCCACACACCCATCTGATGGGTTCAACCCTTGATGAT
TGACGCTTTGTCAACAACGCTTTCAGCATTCATTACGTTGCTCTCACAACGACTATCACTTAGCGGAGTACGTGCCGCTTCAATATCACATAACGAGCTT
TTCTCTATATTCATGTCTCTGATATCGTCAGAATCAACTAATTATGACATTCTGATGTCCAGCACACTGACATTATCATCCAGTGCATCGCGCCAATAGC
GCTTCCGATTCCTTGCAAAGATGTGTTCATTACTCTTCAAAGCCCCGCTAGGGGCAGTGCTCTTTGCGCCTAATGTTTGCGACCTTTATTCGATTTATGG
CTCGTGGAACTCAAGCCAGGCCATACCAAAAATGAGATCATATCTCGAGTCCAAATTAGGGACTAAACAGCGCTCAATACCATCAAAATCGAAAAACTTC
ACACCCAAGTTCACAGAAACTTTGGGCACGGTTACTAGAGTCTCTATCGATAAGAGAACAGTGATTGTATCACCCTTGTGCGCTTGTAGCGCCTCAACAT
AATGTGGATTCCCTTCAAAGGAACATCGCCTGACATAAATACCGGATGCACCGGAGTCTATCTAAATCTAACAGAGTTTGTCAAAGCCCTTAATAGTCAT
CTTTGCGACCAACAAGCCTGGCTTGTATTCACGACCCGTGTTAGAGTGTACGGGACTACTTGGGGGATAAATTCTGCTCGCCACTACCTCCTAGAGACTC
AACAGAACATAGTTCTTCCCCAGCAGGGCACCCCGCGCCTACTGGGAGTCTACGTTTTCCCGCACCGTACCAGACTTCTGTTTAGCAGCGGATTTCGGTC
TGACGTAGCCTGGCGTCAAGGGCAATTAGGTCGTAGATGCTCTGTGCTTCCGCACGTGAAACATCGTCGAATGTTTTAATGTAGTTCTACAGCTTGCAGC
TTTTCTTCTTGGTCCGTCTCGTCGAGACTGATGTCCATAGGCTCCGGCCTATTGGATAAAAAAATTGAGTTCGCCGTGTTTGTGCTGTACTCACGGGTGT
CAAAGCGGGCTGCCTTAAAGTTGAACTTAGAGTTCAACGCGATATCCACAGCCGCCTCAAAGGAGGCGGGGTGGACCCGGAATAATTTCATTTGAGCCAC
GCTCGTACGAAGGCCCTCCATGAAGATGGTAACCGGAACCATTTCTGGTAAGGGATCAAGCTGCATGGCAGCGATTAAAGTTATCCGTTCCTGGACATAG
TCCGATAGTTCTTTCTTGCCCTGAAAGGGAGATAGGAAACGAGAACGCACGCGTTATGCCTGATTTGGCGGAGTAAACACCCGAGATTTTTTCTGTATCA
GCAAATCCCCTGTGGGGAAAGCCTCGGCTACAGACGTGCTACATGTGAGATCCCATTCTATGGCTCTAACAACCAGTTTTAAGATAGCCATCCCAACTCG
CTGTTGCTCCGACTAGAGCATAGTGGGGTTCATGGCCATTTCCAAGTCTCTGATCTACAGAAGGAGATTCTCCCCTTCTTCTCCCTCAAATGTCTTTATC
TCAAGACAAGGGGGCGAGCCCTTGGCTCTTAATCTGGTATGGGGACATACAGAGTAGACAAATCCGATGTCAAATGATCATGTACTTGTCCAATTTGATT
GGATGTAAACTGCATAAGAGCTTTAAGATGTGCACGAATCACGCCAGGACCGTGTGCAACGATTAAATCTACTCGTTCATTCCCGACTAGCGCTCTGAGT
TTCTCCAGCGCTAATCCTTGGGCCTCAGAGAGGTTTATCTTTGTTTCCATCCTTACTGAGGAACTGTCTTTAATGAACTCAGGTAAAGATTTACTACAAG
TGATAACAAGTGTAGCGGAGCTACCCTTACTCCTTTGACATAGGAAGAATTCTGACTCGTAGAGTCTC