Description :
From Genome Similarity Track
Location :
contig_75:10285- 11646
Transcript NameFunction/comments
g11774.t1RAW41743.1 hypothetical protein PC110_g2075 [Phytophthora cactorum

Sequence
1361 bases(100 bases per row)
AGATGAGCCTCATCGACCTGGCGCCCGTAAACACGAAGCGTGCCCGGGAAAACGCATCGCGCACCTTTCTCAAGTTCCTGGCAGACGAGGAGGTTGCCCG
GGACAACCTAGAGACGTGCATGAAGCGCGACAACGCTGCACAAGTGCTGGAGGCAGTGGTGGCACTATCTTGCTTTCAAGGAGGGCCGCAAGGGCCAGCT
ACTCGCTCGTCACTCCGTTATGCAGTACTTCAGGCAAGCCAAGAACAGGCTGTTGGAACAGGTCCCTCAGCATCGAGCCTTGGTTGACAAGAACCTGTTC
AAGAAGGGCCTGATGCTGGAGCGTCATTGTGTGAAGCGCGAGACGGGGGCGTTTGTGAAGAAGGCTCCGGCATGCATGAAGACGGCGCTCAAGAAAATGA
TGGAGTACCTGTATTCGACGGCGGTTACTGCTGCTGACTCCCCAAGACGCGGCGGTGGCGGCGTTGATGTGATTCCTATTCGGGCACGCATCGGATCTTA
CCATGCTTCGAAAGGCAAACGTGTCCGTTGGCTCGGACAAGATCTTCTTCGCCCGCTTCATCCGCATCAAGACATCGGAAGAGCAAGGTCTGTCGCTCTT
TCCCGACGATGACTTCACCACGTGTCCGCTGCTCGCCATAGCGGTTGCTCTTGCGACTCAGACAGCACCGACCATTTCCGTGTTGAGCCAGCTTCCTGAG
CAGACGAAAGTTTCCCAAGCTTCTCTGTCTCCATCCATTCCACTCATCGACCTTCTGGATCACTCACAAGCCGTTACTCCTCCCCAAGATTCGGCTGGCG
AAGCTGGCCATGGTACGAGTACTGATGCCGCGCCTGGTGTGCACAGATACGTCAACCGCGTCCTTGATCTGATTGCAGAGAAGGCAGGTGTCGTCGAGCA
ATTGACATCGCATTCCTTCCGCCGTGGAGGGGCGCAGCACGCGAACGGAGCCGGCTTGCGTGCCCAGTGGAGGCGCTTGGAACATGACGGCGACGAACAA
GGCATTCGCGTACGTCTTCAATACACCGGCCGAAGATCACCAGGTGGCTCGCGTCTTGAGTGGTCGCGACCCGGACCAAGAACTTCACGTTCTCTCGCTC
GATGTCTTTGACTCAGCTACGTAGACGAAAATCCACATGATAGCGGTGGCTCTCTTCAACGCGTCCTACGGGCTCATGGCATCACAGTACAACGTGAACG
GTATTGTACTCGACACGTTCATGGTTTACCTGCTGCGCCACTATCCCTCGTTGAAGAAGCTCAATGAGAACGGCCTTCCTGTGGAGCGCCTGGAAGCATG
TACGATCCAGCAAGGCCATTCCGTCAACGAGCTCCTAGCTTGGTCATCACACCTGACCTGC