Description :
From Genome Similarity Track
Location :
contig_109:102842- 104378
Transcript NameFunction/comments
g13691.t1KUF83890.1 Beta-elicitin DRE-beta [Phytophthora nicotianae

Sequence
1536 bases(100 bases per row)
CTCGTTCCTGGCAGTGGCGTCGTTCAAGCCCACGGTGGTGATCGACAATGGCACGGGGTACGTTCCCTGCATCCCCCTTCCCTCCTCTTTCTGTCAAAGT
TGCAGTATAATCCATTCCGCACTCGCGTGTCAACAAACAATTATTGCTTTTGATCTGTCAACCATTATTCTCGACAAGGTACACCAAGATGGGGTACGCC
GGCAACGCTGAGCCGAGTTACATCATCCCGTCCACGATTGCCGTGGGCGGCAGCGACTCGAGCACCGTGCGCAGTCGCCAGGGCATCGACGACTTGGACT
TTTACATCGGCAAGGACGCGCTGGCCCACGCGTCCACGCACCAGGTGCACTACCCCATCGCGCAGGGCATCATCCAGAACTGGGACAACATGGAGAAGCT
CTGGCAGCGCTCTCTTCCAGCACATGCGCTGCGAGCCAGAGGAGCACTACATGCTGCTCACGGAGCCTCCGCTCAACCCGCCCGAGAACCGCGAGGCCAC
GGCCGAGATCATGTTCGAGACCTTCAACGTGCCCGGTCTGTACATCGCTGTGCAGGCCGTGCTGGCGCTGTATGCATCATGGCCCAAGATCAAGGACCCA
AGCCAGCGCACGCTCACGGGTACGGTCATTGACTCGGGCGACGGCGTAACCCACGTCATCCCCGTCTCGGACGGGTACGTCATTGGCAGCTGCATCCGCC
ATATCCCGTTGGCGGGACGTGACGTAACCCACTTTATCCAGAGGATGCTGCGCGACCGAGGAGAGGCCGTACCCCCCGAGGAGTCGCTCGACGTGGCCAA
GCGCGTCAAGGAGATGCACAGCTATGTGTGCTCGGACCTCGTCAAGGAGTTTAAAAAGTACGACGCTAAGCCGGACAAGTACTTCCTCAAGTACTCGGAC
CTGCACTCGCGCACCAAGCAGCCGTGGGAGATCGACGTGGGCTACGAACGCTTCCTGGCGCCCGAGATTTTCTTCAACCCGGAGATTTTCTCGACGGACT
TCACGACGCCCCTGCCGAATGTCGTGGATGAAGCCATCTTGAAGTGCCCCATTGATACCCGCCGCGGGCTATACAGAACATCGTGCTGTCGGGAGGAAGC
ACCATGTTCAAGATTTGGACGGCGTCTGCAGCGTGATATCAAGCGCCTCGCGGACGACCGACAGGCAGCCAACCTGGCCAGACACTCGACGTTCCAGCAG
GCCCATGCCGAGGCCCTCGAGGTGAACGTGCTGTCGCACCGCATGCAGCGTTTCGCGGTCTGGTTCGGCGGCAGTATGGTTGCAGCCACTCCCGAGTTTT
ACCGTGTTTGCCACACGAAGGCCCAGTACGATGAGGAAGGCCCGCGCATCGCGCGCCACAACCCGGTGTTCAACACCACCATGTAAGCGCAGCATCTACT
GATCAACGGCTCAGCAGAAGCAACGCGCGCGACAAGGAAGCAGGCGCGTTCGTCGTCCTGTACGAGTGAATACACGGAGGACGTAGACGAGTAACGTGAG
AAACCCAGCAAGTCAAGAAATACAAGCACTCAACAG