Description :
From Genome Similarity Track
Location :
Scaffold_491:10280- 11483
Sequence
1203 bases(100 bases per row)
TTAACCTTTTCGCGGTGTGAGGGCGCATTTTTCGCCTTTTAACCTTTTTATCAATTCATGGTGCATTATGATAATCTAAAAGGGCGttttgcgccctttt
agCTTCATTCCACTTCCCATCTACCGTGTTTTGTTACTACCAATAAGAACAGTGCATCTGCAAAGGGCTGGGGGAAATTTTGAGTGCTGCGCACCGTCGA
CATTTATTTATTGCAGTAATCGGACATTGCCACGTCACCACCGTCATCCATAAACTGGCCATAAACGGGGTGAGATTTCGCTGTTGTTTCCTGCCATTCA
TACTCCCATACAAACGATAAGATACATGCACCCAAAGTGATTTTTCATTACTCATCATACAAATGCCAAGCTAGATGCGTACAACGTTTACAGACTTCGA
AGATAAAGTACTGAGCAGATTGCCTTCCAGTTCGAGAACGAAGGCCTCCATATTACCTGTGATTATGTCGCACGCCGTATGAAAACGAAGCGCACAGCGC
GCGAGCTCCACCTGCATTTAGCCAGCCTCAAGCGCACGTACGGGAAGTCTATTCCAGACTTCCCGCCGTGCTTCTTCGCTGGGCCCCACCTGAGACAGCT
TTTAACAGCTTCGGGACTACCGCTACCGTCACCCCTCGTTCTCCAAACATCACCGAGACCCTCCTTCTTAGCCACACCACACAGCAGATTTGGCCGCCAA
CTACGTTTCATAGTTGGCGGCAGCGCAGCAAGTACAACAGGTGCGTgagcgtcgtggagctggggTGCATGACTGTCGgcattgctgttcttgtttgtgt
tgctgtaggtagcgttggcgacggcgtcgttgCTAGAGATGTCGGAGGTGATGGCAGCGTTTCTGTCGGTCAGGCAGTCGCTCCTGGCTGTGGTGGGCGA
GGCGCATGTGTCGGATGTGCAACAATGCACAACCAACGACAAGCCATAGAGGCTATAAATTCTATATTTGGCAGAATCAGGACAGAAGATGTTCGACAAC
ACTCAGAATAacgcggggggggggggggggttctGCCGGTTGGTGTCGCCACCTCAATCGATGCCTATGGACCGGTAGGAGATAATAATGTTTTTCTCGA
TATTGGAGCTGGCGTAGGTAACAATCTTGCCCAAGTTGCACTGTCGACGGCGGTTAGTGCATGCATTGGCATCGAGGTCTGAAGGGACCTATGCTCGCTT
GGG