Description :
From Genome Similarity Track
Location :
Scaffold_2083:1028- 2589
Sequence
1561 bases(100 bases per row)
AGATCTCGAGCGCTACCTATGGTTCTGCTCGCTGGATGCAGCAAGCGGCTTCTGGGCGGTCATGATGACCTAACGAGCGCGTAAAGTGTCGGCGTTCGTC
TGCGCACTAGGACATTTTGAGTGGTTACGCATACTCTTTGGGTTAAAGAACGCGCCGATGATCTACCAGCGTATGATTGACAACGCACTCTGGGGGTTCG
TTCAACCTAAAGGAGGTTGATTTGAATACTCGGAGAGGATGCGTTTAGCTGAAGAACAGGCCAAGGAACGTCGTGGACCAAGCGCCGAGGGTTCGTTTCA
AACGAAGCTCGCGGCAGACCGCGAAGCACCGGTAGAGACCGACCCTGTACTACAACTCGTCAACAGCCCCGTCGCTGACATGTTTACGAGCGGGGAGCCA
GACGAATCATCGCTGGTACCTGTATTTGGTCGACGGTCGTTTGTGGATGACATTTGCTTCGGTGGCGAGGATTTCGACAGCTGCCTGGCGACGCTGGGCC
GATTGCTAGCAAGATTCGCACAGTGTCGGATCAGCATTAGCTTCACCAAGAGCATCTTTTGCCAACCCAAGGTGGACTTTCTGTCGCATAAAATTTCGCC
AGAAGGTATCAGAGCTGACCCCAAGAAGCTTGCGGCCATCACCGAGCTTTCGTTTCCAACGAGCAAGAAGGGCATGCAGTCGTATCTTGGAGCGGTTAAT
TACTACAGCCGCTTCATTCAAGACTTCGCGGTCTACGGTGCGGCGCTGTACCAGCTCAAGGATGAAGACTTTGTCGTTGAAGGTGGCCTTTCTGTGGCAC
GTCGTTCCTTCAAAAAATTGAAGACGAGTGTTTCACATTCACCCATCCTCAGGCACTTCGATCGGTCGAAAGAAGTTCACGTCATGCTCTTTGCGAATGA
ATGGGCGTTGAGCACTACGCTAATGCAAGAACATGACGGCAAGTTACACCCCGTACGGTTCCTCGGTCGGGTGCTCAAGGAGGCCGAGATGAACTACCAT
CCTGCTGAGAAAGAAGTTTTGGCGTTACTTCTGCTGTTGAAGATCTGTTACGTCCAGCTGGCAGGAAAGACGCTACATGTCTATACACGATTCTCGACGT
TAGAGTGAATGCATAAGTCGAAGTCTCTCTTCGGACGTGCGGTCCAGTTCGCAGTGCTGCTATCGCAGTGGCACCTAAAGGTGCAGCGCGTGAAGGAGAA
GGATGTCGCCTTCGCGCAGCTACTGCAGTCAAGCATCACGAGCTTCGTCGACCTGGAAGACTCGCTCGCGCCGGTGGCTACGGGAGTTGTTCATGGGTGC
TATGGAGCCTTCCTGAGTGGAAGGTAGTGATTGCTGCAAACGCTTACCTCTCGGCCACCACGGTGAATGAGGCAGAGTACACAGGAATGATAAGCGGTGT
CAAGGCTGATATTGCGCACGGTGGTGAAGTGCTTTCTCAGAAATAAGAGAAGGGATTTAACAAGGGTCACTATCCCGCATTAGTGACATCACCAAGTGGT
TAGGAGGGATTTGGATCGCCCGGCATGGATCCACGCTTCTCGGAGTGGATTGGCCAAGTAA