Description :
From Genome Similarity Track
Location :
Scaffold_2769:1028- 2192
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2769-snap-gene-0.0Gene of unknown function

Sequence
1164 bases(100 bases per row)
ACGACCCAAAGTGACTATCGCGATCGCGCGCTGGTACTCGGCGACGCTGCGGAATCGGCATTGGCATCTTTCTTGAATGAGCGTGGTATCGTCTCGGTTG
GGGCTGGATCGATACTGAAACACATGCGTCAGTTTCACAGCGCTGGCGCGCTGAATATTCGCATTGCTCGCTATCGCGCTCAGCTCGCGATCGGTCAAAT
TGTTGATCCTGCTCCTCGGCACACACAGGACATTTTTACGATTGTGTAACACCGCAATGTAAATCATAAATCCACTTACATTTCAGTTTCGTTCGCATAT
TAGCAATCATTGAAGCAGACACATTGAGCTGACAGGCGCAGTCGCGTCGCGATCAAATGCACATTCGGCGGTGTCGGCACTGGTGCCGATGGCGGGCGAC
GCGACCGCGGCAGTTTACACGAGCTACGCGCCAAGCGCGTCGCCTTCAGTTTCTTCTTTCGCAGTCGTGTCCTGGCCACAGGCGCTGATGTGTCGCGGTG
CCAGGCGTGGTCGCGTCGCGGTCCCAGACACTGTCGTGGTCGCAGGCGCTGATGTGTCGTGGCCGCACGCTCTGTCGTTATCAAAAGCGCAAACGCGTAT
CGTCGTCGCACGCGCGATCACAAGCGCAGTCTTGTCGTTTTGTAGGCGCAGTCCTTCGTGTCGCACCAACGTTGCGATCGCATGCGCAGGCTCAAAGCAA
TCACGTTTGCAGTCGCAGTTGCGTCCTTGTTACAGACACAGCACACAAACACAACCAGACAGCTGCCACATTCGCAGCCAACCAGCAAACCAATCGTAGT
CGCATTCGCGTCGCGGACACACGCACAGTCACAGACACAGCCGCAGACTCGGCACATTTGCTGGAGAAAGAACGGCATCATACATACACATGGCTCTCAC
AATATATACGCACGCATATAACCGCTCACCGTCACGGAAATGCAAATTGCGGACACGCGAGATACCACCACCGGGGATCGAACCCGCGCTCAGAGGATTC
TCTGTGCGAGTCCCACTGGCCATGGTGGTTCGTTCTGGAGGGGAAATCTTGGCGGCAGCTCTGGAAAAATGGTGAGTGAGCGCTCGTTGGGCTGTTGCCT
GCTTTGCCGATTTCTGTTTGTGTCTACAGTGTGAACGTTTTTACGCGGATGTTTTTACGTCATG