Description :
From Genome Similarity Track
Location :
Scaffold_175:102790- 104301
Sequence
1511 bases(100 bases per row)
CTTGCTATGAAGTATGCTCTAGTCAAATTCAGAGTTCATATGCTTGGCTCTAAGCCTTTTGTCATGATTCTTTACGCACGGCGACCCAATCGCCTCACGT
CTCGCTGAGGATGGACCACTGGCTTTCATTCTTTGCAGAATATAACTTCGAGGTGAAGAATAAGCCGAAAAAGCAAAATACGCTGGCTGATGCGCTGTCA
CGACGGCCCGACTATGAGCTTGCTCATGTTATGATTTTGTCATCGTCAATTACTGACTTAATCCGTGCATCTAATGCCAAGGATGAACAATGTATAGCTT
TGCTACGTGCTCTTGGAAGCGATAGGTTTAAAGACTTGGACATTAAATTGTCGGCATGTTCGCGTGCGAGGCTACATCGATATTCTATCGATAACGGCTT
GTTGTGCTATCGCACGGATGCCGTGGATAGCCCGCGTATCTTTGTTCCTCATGATGAGGAACTGAAGTATAGTATCCTCTAAGAGGTCCACGACACTGCT
ATCAGTGGTCATCTCGGTCGTGAGAAGACTTACGGCTTAGTTAGTCAGAGTTATTGGCGGCCCAAACTCTATAAATGGGTAAGCACTTATGTGCGCACAT
GTGAAACGTGCCAACGGGTCAAACCATCGGCACATGGGACTGCACCACTGGCTAGTTTGCCTGTACCCTCTGGGTGTTGGGATTCCATCAGCATGGACTT
CGTGTTCGGTCACCGAACGATTCGGACGGTACCACAGGTATTGTGGTCTTTGTCGACCGTTTGAGCAAAATGGCTCATTTAGTGGCTGTGCCGGATTCGA
TTAATGGTGAAGGTACAGCTTTGCTGTTCATTGATCGCGTGGTTCGCCAACACGGACTGCCACTGGCAATTGTCTCTGACCGCGGTTTTCGTTTTATGGG
CAAGTTCTGGAAGGCAATTATCAAGGTGCTCGGCACCAGATTAGACATGTCTACCACGGATCATCCGCAGACCGATGTTCATATTGAGCGTGTTAATCGC
ATCCTCAGTGACGTCTTATGCAGCGTGTGAGATGAGACGCCTCGGCAGGCTATACTCCTTTCTACGTGAGCGGCCTCACACCCACGCGTTTCGTTAATGC
TATCACTACGTAGCTCAGGGCTTGGTGGGGGAGAGGTAGCCGATCGGCTCGCTGGTATCAGTTCTTTTTCTGTTCAAAAACAGTTTAGCGCGTTTATCAC
AACGCGATTGAATGTCTTACGACATGTGCGTGACGCAATAGCTGATAGCCAAGACAAACAGAAGGAAAAAACGGATGCTAAAGGCAGAAGCTGTATTGAA
AGTTATGAGGTCGGTGACCAAGTCTTACTAAACGCTAAAAACCTACCTAAAATGTAGTGTCTGCTGTGTTTTAGATGAAGCTTCTTCCTCTCTTCATAGG
ACCATTTACGGTCGTGGCCAAGAAGGGTCTTTCGTCTAGATTCAATCTTCCACGCAAGTTGCATGCACAGCCCATGTTTTACGTTGGCCACCTTAATCCG
TGTCGGGATCC