Description :
From Genome Similarity Track
Location :
Scaffold_67:102781- 110418
Sequence
7637 bases(100 bases per row)
TTTCTTCATTCTTCAATCCACCATCTCGACACCGTATGTCCAAGCGTCTGAATCGAGCCGTGTCCGACGCTTTTCAGCGTCTCAATCCTCGTAGACGTCG
CGAACGTGAACAGCTGGAGGTACGTCAGCTCATCCTTTTCTTGAATCATTGGCACCTTGCTCATCACTTCGCATTACTCGACTTGTTTCTCAGGAGGGCA
AGGCCGAGGGTTCGAACGCCCCTCAGTCTGCTGCACTTCCTCCGACAGCAGCGTCATCAACCGACCCTCCGGTGCCCGCTGCCCCGGACTCTTCACTCCC
TGTGGTAGCTCCTGCAGCACTCCCCGTCGTCGCTGAACCCGCGGAGATGGCTCCTGCTGCTCCTCCGGCCCCAGCTGGTGGTCCGCCACCACTCACCGAA
GATTCGCTGCGCGCCATGCTGGCTGAAAGTACGGAGGCATCGGCCGATCATATGATGACCTCGATAATCCCGTACTTGACTGCAATGGCTCGTCACCAAG
TGCAGCTCAGCGTTGCGCCTCCTCTCCACGGCGATATACACACTCAGCGTCGCCTCGAGACTGCCGTTGGTTTCGATGATGTCCTCGCTGCGATACAACC
TGTTCCTGACGCGCTGTCGGCATTACCGGAACGAGTTGCCGACTTGGAGCGTCAGTTGCGGTTTGCTCAGTCCGAGGCTGCTGCCGCCGTACGTTCGGTG
GCACCCCACATCATGGCTCGTGAGAACGCGGAGACATTCCTCAAGGCTGCCAACGCTGAGATTGAAGCCTTACACCACAACATCAAGATTCTCCGCGAGT
CGAACGCCAAGAATGACGCCATGCTCGCAAGTGTTCAAGCCACTATGGAGCGACACGCAGAGGATTTGAATCGTCTTCACTGCAAAGTCCAAGCTCGGGA
CGTTTTCATCAGCACTTTGCAAAAGAAGCTGGCTCGTGAACGCGAGGTGTACATGTCTTCTATTGGAGCGAATACCGAGCAGACTCGGAAGCTCCACCTC
CTTCTGGTAAAGCTTGCCCAGGGCAAGTACGTTGATAACGACACGCGCAAGGTCCTCGAGAACCAGCAAGACCGTAGCACTCGCCTCCTCCAAGCGAATC
GTACCCTCCGGGCACACGTGAGTCTGGCAGGGATGGATTCCGAGGTACTTCGTCTGGCTGTTGAAGGTGCGCTCTTAATGTCGCTCCTTCCACCGTGTGT
TCAACAACTAACGTTCGTTCACAATCCTTCGCGATAGGTCTGACTGCGGGTGAGCTGGACCTGGACGCGCTGGACTTGGATCAGGAGACATTAGTCGCTT
TGCGGCGCATTCAGTCTACCACCGCGTCGCGTCTTCGGACGATCCTCAAGCCCTTCCTGCAGCTTTGGCCAAAGCCGCTCACCAAGTGGCCCATGGGAAG
TCCCATAAGCGTCTTAGACCAGGTGGCGAGGATTCAGACGACGAGTCGGAAGACTCTGACGAAGACAAGGCTCCGATCCCAACGGACAAGGCCAGTACTT
CGATGGCAGCTGCCGGTCTCGGTGATGCGCCACCTGCCGATACTTCAACTCCCAAGTCGACTCGTAGATCGCTGTTCGGTCCGAAGGCGTGGAAGAAGGC
GGCCCAGAAGAAGCGCAAGAAATCTTGTCCTCATTCATCTGCTAAGTCGCCCCGACGTCATATGAAGACTCGGTCCAAGTCTATACCGTCTTCTCCAAGT
TCATGGTCGCCACCTCCTACACCAGCGCCTTCCTCGACTCCCGCCGTGGTCGACCTCAGTGGCGACCAGAGTGACGTGGACATGGGGACGGCTGATCCAA
GTAGCGTCCCTTCGGCTCAAGAAACTGCTACAGAGCCTTCGGGTAAGGATGTGAACCCTGGGGATCACGACGATGTTCCCGGTTCTCCTGACGCGCCTTC
GCCCCCGCCTCAGGTTCCACACGATGTGGCCAAGCCACCAGCTTCAACGATTTCACCTTCTCCAGCCGACATACGTGCTGCTGAAGAAGCTCTGCGCGAG
GCCGAGGAAATGCGGCTCATGTTTGGATCGAGTGACGAAGGTGAAGAGTCGGACCAAACTGTCCCACAAGGCAAGTCTGCTTCGGCTTCTGTTCCGACGT
CCAAGACAGTTGAAGTCTCGGGAGTGGTTTCTACAGCAGGGCCTGCCCCTGTTGAAGCTGCTCCACCAGCCTCCGTGTCTTCAAAGCCGGCTCCGATTGT
TCCGACGGCTGTCGTACCAAGCGTGTCTTCGCCCGACTTTTCGATGGAGATTGATGACGATGGGAATGCTGATGACAATCATGGAGATGACGTGGATGAC
AATGAACCTTCGGTGGGTGACTCTCCTGATGCTCCCAGTGGTGGCGGTGATGTTCCGCCCCCCACCGATCATTCAAGCATACTCGATGACGAAGATATTG
AAGATTCCAATAGGAGCTGGAGCAATCTTGGCCCAGCTCGTCCTCCGACTCCACCTCGGCCAAATCCTTCGCCGATGATGACTTCCCCAATCATCGTTGC
CGGTCCGCCTCCTTCGCCACCAGCAAGTCTTCCAGCACCAGCATCTTCTCCTCCTGTTCCAGTGCCTCCTCGTCCGCCTATTTGGACTCTCGATACTGGA
CCTGGACGCATGATTACGGCCACCTACACTTCGGTGCCGCGTCGCGGTGGTGCACCGTCGGTCGAGCCGTTGCCTCACCGAGTGTTGTCTGGCGGTCGCC
CTACGGTGCCGGCTTCGTCCACCTTGCCACCGTGGGTTCTTCTGTACGTGGACATGGAGTTTACTGACGCAGGCGCCAAGAAGTGTTTCGAGCGACTCTT
GAGCTTAACCCTTCCCGAACCAGCTGGTGAGGTGACCGTGCGTACCACGTTGGAGGGTCTCCAAGCGTTCTTTGATTACTCGCACCCTGATCACCCGTAC
CAGCAACTTCGGCAGCTCTATCTTCTTCAAGCTTGTCTCTTCGACACCGTCGACTTCAACCCAAGCGTCCGCATCTCCAAGCGTGCTCCGATTGAGACCC
GTCTCAAGATGATCTGGGCGAACCTTCAAGGTGACCTCGGGTTCGCGTTGTGGGAGCGTCTCCACTGGCTTCCGTTGGCTGGTATTGAACGAGGTCTCGC
TGAAGAAGCTAAAGAGGTTGGCCATGACAAGGAACGTTTGAAGGAACTGAGAGCTGTGTTAAAGAAGCTCTTCAGTGAGCGCGACCGTCGTGCCGATCGT
CTTCGTAACAAGTACCGTGAGCAGTACATGGCGTGGAGTCGTGACTCGGTTTCCTCTGGTACTTTTGGCGCGCCGTTCATTCGTCCCGAGTTGCTTTCGA
GCCGTCAAAACCGTGGTACCCAATTGAAAACTTGTCGTTCGCACCTCGGACATCTGACTGGCTTTCCGAAGTTCCGGCTCTCGACGCTCGTCAGCCCTGG
CGTACAGGATGGATGAATGCACCGCATCAGCACCCGTACAACACCACGTACTTCCCGTGCCAGCGTAATCCGGAGCTTTTCAATCCTCGTGGTACGCGTT
TCGTGGATGTGTACCGAAGCGTGATCGTTGACCCGTCACTCGATTCAACCAAACTTATTCCGACCTGGCGTTCGTTGTTTGACTCGCCACCGGGTACTCC
ACGTCCCGCTCTGGCTGCTGCTCCTGTTGAAGCTGGTACCGAGGATTTGCAGGGTCCGGCTTCAGCTCCAGCTGCCGAGGCTCCGGCTCCGGATGAAGAG
GAGAAGGAGAGTGGTGACTCAACTTCGTTGGCACTCTTGGCCACCGCGGCCAGGCACTTGGAATCGATTTGAATTCTCGCTGCACGTTCCACGACGTTCT
CCAGCATCTCAGCTAACTGTTGAGGTGTCCCGCGTGACTTCGTTTTCAGTGGTCGCTCTCCGGTCGGCATTCATGTTTTCTTATTCTTAATCCACTTCCA
CAGCGTAATCATGTTCATGTTGTTCTTCAAATGCATATACAATTTGTTGTTGCAGTAACGTTTTTCGTCTGTTACCACAGGCTGCATCGCCCTGTGGACA
GTTCACACGTGATCCAGTCACGCTAGTCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTCTCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAGACC
TCCACATGACAAGTTGGATGCTGGTTCCCAAGTTGGATCTTCATAACCCACCCACTTGACTTTGAATTCGCGTACAGCACGTTATGTGCTCGTCGACAGG
GGTGTTCTGTCGTCGAGGATGGCCTCGACCTCGTATTCACAGGCAAACTTGATCTGGTTCCCAGCTGTCTTCAGGCAGTAGTTCCTCATCGAAGTCGAGT
CTTGCTTCATTAGTCGCGTCCAGTACCAACCGAGTGCTCGGTCGACTGTTGAACTCGTTGACAGCCTTGCGTCTCGACACATGCACTACTGGGTAGAAGC
GATACCCACTTCGGTCAGGCAGTTCCAGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTTGT
CAAGCCAGGTTTGACGCGTTCCATGTACAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGAGCTCTTGCAGGATCTTCCATCTCTTCCGAA
GCTTCTGGAGGGTCCGCCGAGTGTTCGTTTCCACTTGGTTGAGGTACAGCAGCTTTTTCCAGTCAACTCAGGGCATCATTATGCTTTTTAGCCCTTCGCT
CCTTTTCTACAGCCTGATAATCTTTGGCCATAGTGAAGCGACCTCATGTGTCGATTGATCTCACGCCGCCACGTCAGTGCGTCGGACTGCTTGCCGAGTC
CTCGTTTGATTGATGACGACATGGCCGCTACGTCGACTGCGCATCCCAACCATGAACGAGGTAGACCGGAGTTTCCTTCCTCGTAGTGTCTTGAGAAGTA
TAATAGCAAATACTAGCTTCTCCGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGACCCCATCACTGACTTCACCGAGCG
TTCCTGCTGTCCATTAGCCTGTGGTCGATAGCTCAAAGTCGCTCTTGATCTTGACTGCATCATTTCTGCAAATGCTTGGAACACCTCGCTCATGAAGCGT
GGGTCACGGTCGTGCCTTATCAGTGATGGGGCTCCGAACCGTCGGTACACACATTCTTCGAACACTTGGACAACACTCAGTGCAGTCGTATCTGACATAG
CCTCGGCAATAACGAATCCCGTGAACGAGCACTGAAATAGGAGCAACGCCTTGTTGCCCCTGCGAGATTTAGGTAGTGGGATCACAAAGTCCATCGAGAC
GATCTGGAAAGGTCGTTCGGCTAGTACGTTGCCGGGCGAGTATCCACGAAGCTGCGGACGGCTGTTACTCGAGCTGCAATCTGGACATGACTTCACATGC
TTCTCCACATCAGCGTACAAGCCGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGAC
AGTTCTGCAAGACCTCTTGAATCATCGTTGTCGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACAATTCAATCCAAGATA
GTGAAGCACGCCGTCTTTAGATAATACGAACCGGTCAGCATATTTCCAGGCATCTCGAGCTTCTTTGTAACTCAGCTCCTCTGCTTCGCCCTAAAGCACC
TTCTTGATGTTAAACCACTTCTGCTCCTCGTCTTGTGCCACCAGTATCCGTCTGCGTCGTTCCCGCTGTATCGCTACCGGGTCAACATCTTCCGCATCGG
GAAATGCCGCTGGTACAGTCTTGTGAGGATGGTCTAGCAAATCTTCGCCGGAATGAATCTTCGGTGGACGTCCCTCGTCGTTTTCGGGCTGATCTGAGCT
TTTGAGACATCCTCCGAGTGTTTTATTCTGCCAACCTGACCGCGATTCTTGCCTTTCGTCTGTCGCCGAGTCATCACTGCCATATTACCATAATCGCACT
TTGGTGAGCTGTAATCAACCACGAAATTTTCGAAAGTTTTCCACTTTGAAGATTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCACGTGACGA
AACATCTACCGAGTCTTCACCCAGCTCGTAGATCCTTTCCTGGATGCGATTCAGCGACGCTAATTCCGACTTGCGAGTTTCAGCTAGGATAACACGGCTG
ACCTTTGATTCCAGCGCTTCAGTGGCTAACGAATCCGCGGCAGCGTTGTATTCTCGTACCACGTGAAGATATTTAGCTGATCGGAGCTTGGCCGCGAGCT
CCTAGTTAGTATTCAGCAGCGCTAGCAAAGTTTCCTTTCTGCATGTGATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCGCCAACGATGACTAA
ATCCTCGGCACCGTGCGCAATAGCGGCCTTGACACCGTTAATCATCCTTGTATACTCTGCCTCATTCACCGTGGTGGCCGAGAGGTAAGCGTTTGCAGCA
ATCACTATCTTCCACTCAGGAAGACTCCACAGCACCCATGATCAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGA
ATCCGCTGTAATTACGGGAAAGCTTGGCGTACAGCAACGCGGGGTCCATTCGAATAGTCGGGGAACCCTTGTGTGGAGGTGCCACCGGCGCGAGCGAGTC
TTCCAGGTCGACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCGAAGGCAACATCCTTCTCCTTCACGCGCTGCACCTTCAGGTGCCACTGCGATAGC
AGCACGGCGAACTGGACCGCGCGTCCGAAAAGAGACTTCGACTTGTGCACCCACTCTAACGTCGAGAATCGTGTATAGGCATGTAGCGTCTTTCCTGCCA
GCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCAGCATCCTTGAGCACCCGACCGAGGAA
CCGTACGGGGTGTAACTTGCCTTCATGCTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTGCTTTCGACCGATCG
AAGTGCCTGAGGATGGGTGAATGTGAAACACTTGTCTTCAAATTTTCGAAGGAACGACGTGCCACAGAAAGGCCACCTTCAACGGCAAAGTCTTCATCCT
TGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGACTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTACTCGT
TGGAAACGAAAGCTCGGTGATGGCCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGTGACAGAAAGTCCACCTTGGGTTGGCAG
AAGATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTGCAAACCTTGCCAGTAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGA
AGCAAATATCATCAACAAACGACCGTCGACCAAATACAGGTACCAGCGATGATTCGTCCGGTTCCCCGCTCGTAAACATGTCAGCGACGGGGCTGTTGAC
GAGTTGTAGTACAGGGTCGGTCTCTACCGGTGCTTCG