Description :
From Genome Similarity Track
Location :
Scaffold_756:10278- 11281
Transcript NameFunction/comments
g11492.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
TACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAGGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATG
GCCCAATGAAGCGCGGAGCAAGCAAGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAA
TTCATTTGTGTTTCCCCTGCCGATGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGA
CGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTA
AAGTGTCTACGCCCGTCGTAGACACTGCGTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTCGTATCAGCGTG
CTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTC
ACGTAGAACGGTGTGTGTCCAGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGT
AGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGATGATCCGCAGTCGACATGGACAGCTGTGTCCCAAGAAG
TGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCTGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAAC
AGACATGCCGTCTGTTTGGCTGCCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCT
TGT