Description :
From Genome Similarity Track
Location :
Scaffold_110:102771- 106842
Transcript NameFunction/comments
Hyaar_Emoy2809819hypothetical protein

Sequence
4071 bases(100 bases per row)
CGTACATTGTAGGACCTCATGTCCTCACAAGATTAAGCGCGCTGTATGACCTCAAGCGCTATGTCGAAGCAGTCTATCGAATAATTCATGCGCAAGATCC
ATTCCACTACGTGAGGTATGTATTAGTGCTTATATTCTGAGCGCTTTAGTTCAGATAAAATGTTTGTAGTAATTTACGTCGACGAAATAATCCTCGCGTG
CAGAGACATAGATCTACCCGCGGAGATCAAGCGTGTAATTAGTATCCACTTATGCATGGATAATATCGGCGCACTGAACTACTTTCTCGGAAAAGAAAGA
AGCGCGGTGAATAGCCAAAACTTGTTTGGATGCGTCAGACCAAATTAATGCGGTCGATCTTGACCAAGTTTGGCATTCAATACAGCTGACCTGTGAAGGC
ACCACAAGACCAAGGACTTAAGATGACCAGGATCACGTTCGAAGGTGTTTGCAATCACAGCTAAATCATGAAAGACGTACCATTCGAAAGTGCAGTGGCT
GCGTTAATGTACCTGATTGTTGTCACCTGTCCGGACCTTGCTGCATATGTGAATGTATAAGTCAGCTCCCTGCAGACCTATCCCCGATGCGCTGGTAAGC
TCTGAACGTGTTTTCGGTATCCACGAGAATCTGCGGCACATGTAATTTGTTTTTAAGATGCAGAAATGTGATATGGTCGGTTAGGCTGATGCAGACTAGG
CAGGTAAGATCGAATTTAGACGAAGCACCGGCGAGCAAGCATTCATGATCAATGTTGGCCGCATCAGTCGGCGCAGAAGGAACCGATCACGGTGGCTATC
TTTTCGACCGAAGCCAATTACATGTCTTTGTCGGAAGCTACAAAAGAAAACGTGTGGATAAAATGTTCCTTCATTATCCAGTCGAAATCATGGGTAAAAA
CCCTCTGAATCTTTATGAAGACAGTCAAAGTGCAATTGCATCTGCCATGATTCCTAAATTCCACAAGCGAATTAAGCTGATTGGAAGCCGCTATAATTTC
ATGTTAGAGAAGGTTTCGACAGACATGTGGAGCATTTATGATGCTTAATAGAGGACATGAAAGCATAAATGATGCTTAAGCCGATTTTCGCTTCCTAATT
TGACCATCTACGCGGAAAGCTTATTAAAATGGCGAAGAGTTCGAGTAAGTGTATTGTTGAAGAATGGTCTCAATCCGAAAGCAGAAATCAATGCTATTAC
ACGCCGTAGTGTTTAGTAATGCGCGATGTGACAATTACAAATGCGCGACTGTATGATTAGTAGTGCGCTCGCTATCTATAGGTTGATGAATTTGAATAAT
CTTGTAGGCCTAGAGTAGAAATGAAATTGCGAACTAAGGGCAAGAATGTATTCACTATGGATTTTCCATGTCACCAATGAAGCCACTCTATATAATTTTT
AAAAATAAAAAAGGGAACCGTTAATCTTCCCTCAGTTTCTGGTAAATTTCTCTTAGTTGAACATAACGCTATATGAGTGGCTATTTTACAGACATGCCTC
TAGGGTATTATATCACTATAACCGGGTTTTCTACATCTAATTGACCTAATTCAGCATAGTTCGAAATTGTTCTTATATGTGCTCTTTATCTTAACATTCA
GTCAATCTTTGCCTATAAAGTTTGCTGACTCGAAGCTTTTACGTCCGCAGATGCTCTCAATCGCTCATTATATATTAAAGGTCTACACTTCTACAACAGC
AAGCAATCCCCATCACGCTTACATGCAAATGCTTTTGCGATAGTGAGTGGTAGACTGCTTCTTTCTTTATTATTCATTTTCAAGCGTATTCAAATCATAC
ATATCGCGTGCACGCGACGAGTCTAATAAATATTTGTCCTGTTCGTTACTGTGTAGATTCCAATATGCTGTTCCGGATCTGTAAATGTGCAATGTAGGTC
CGCATAAGAGCACGCAGGAGGACATAAAGATGGTCGGGCACAGGGAGCTTATGACCAGCGCGCATGCGTAGCTCAAACGGATGCCCCTGTTATTTACGAT
GATGTTAAGGCACTGCAACGAGTGAGATTCTTTACGATAATCTAGTTGCTGGTTCTGCCAATCAAGCCGAGGAAACTGCATGCTCGTGTAAGTAAGGGTC
TATCTCAGTAATTACGAGCTGCAGTGCCTACAGTGTTAGTAGACTCGTACTGGGGAATGCAGTCAAAGTTGTTTTGATTTATAAATTGGTTCCGTTGAGT
TATGTAGGTGTTGATTCGATACAACTTCCACATCGTTGTGCATTGTAATCCACTCTCATGCAACGGTCACATCTTCTTCGCAATTTCTAACGAATTTATT
GCATCAGTGATGCTGATCGTTGCTTGCTTCGGTTCGATATGATGGGTTTACACTCACTCACATTTTTTGATTTTATGGACGTTGCCTACTGTGGCTAAAC
GCCGACTATGACGTCCACCACACAACATTTTTGCGCAAAAAGGTTCAATTGTATATGACTACGACAAAACTGACTTTTATAATCCAACTGATAGTGATAT
CGCTCCCTCTATTCGTGACTCATAAAAGCCAATCATGTAGCGTTATATCAAACTGAGGGGATTTAACCAGAGGACAAAGTTTTAATGAAATTAGCGGTAT
AGCAATAAAAACTGCAAAAAAAGGTTTAAAAAGCAGGTTCAAGTAAACTACCTGTTTACTCAAAAAATATTTATATAAATTGTCCGTAAAAACAATTAAC
GCGTTTGGAGTATAGAATAGCAAAATATATAGTACGGATTATACCCGCCCCACATCTTTTGCCAAGTTTCGTGACTTTAGCACCACGAGTCGTCCCCATG
AACGTCTGCTTATAAAGGACATAGCCAGAACAGACAATATCACATTACATGAATTGCTAATGGCCAGCATGTTCCACTTGACGACGACTCGAGCCACTTC
GCTTACTAGTTTGGGGTTAACGGCTGGTATTCCGTGCGATTTCTCCATATACGCTATAGCGCGACATACAACAACTGCGTGTAGGTTAGTGAGCGCGCGT
TTCCATAAATGTCCCTTGCCTTATGTACAAGGCTCAACTATGAAAGCGAAGAGTGTCGATAGGACGACGCAGTCCACAATCACTGGGCCGTACCCTTCGT
TCAGCTCCCTCCTGTACTCCAGCATGTCGTCCACAACCTCATCAACATCTAATTCGTCTATATTCTATCGCCATGATGTTGAACTCGTATTAAATGTGCT
GTCTTGAAAGCGCACATTTGCTATCCTCACAGGATAACCTCACGCGTCAGGTCCAGCGACTTAAAAAGACCCAGCGCATTAAGGCTATCCAGCTTCTCCT
CTACAATATGTCAATGTCGTAACGCGCACGTTGCCGACATGTATGCACGGTATCTTCGTAGAGATCCTATACAGTAAAAATGAAACCATAGTAGTAGGAT
AGAGTGGTGTCACCAAAGTATGATTCGGAAACGATGCTGGACCTCAGCAACCACATCAGCGTCATCGGCCAAACCCACATGTTTGCACCTTGCGTCGAAA
CAAATAAACATTTGAAGTTTCACCTTCAGATGCCTTCTACGCAAACACAATATTCGCTTGTTTATGCAGACATCTCGCAAATGTGCGCTTTCATTTTAAA
TGGATCGCGTTAGCGCTGTAGATCAAGCAGTTGAAAAAAGAGCAGCTTAGCACAAAGGTATCCCCGGACAAGTGCTCTCCTTCATCAGTGTACGCAAATG
TAAAGTAGAGCGCACGGGGATTAGGTAGTTTGTTGCTATCGAATACCAAGATAATGTTTAGCACACTCCTGACCTCCATAGGTCTTATCAATTTTACGCA
AGGAGTGCAAGAGACATATCGGGTCAGCTCGTGAGTATTTTCACGGTAAATGACGATCTGGGTTGCGTAAAGCTTTATCTAATAGGTACCTCCGGGCTTG
TATGGGGCTCTTACCTCATCCGCCAAGAGGACAGTGACCCCTTTGATCAATTACAATTCCAAACGCTACGCCGATTCGCGGCAAGTCCCGATATGTACTA
GCGCCTGCTCCATATGCACTGATCCATTGCCTCCCTTAAAAATCTTGAATTCAAATCTTGAATTTTCCATG