Description :
From Genome Similarity Track
Location :
Scaffold_759:10277- 13152
Transcript NameFunction/comments
Phyta_totarag10568hypothetical protein PHYSODRAFT_470921
Phyta_totarag10569conserved hypothetical protein

Sequence
2875 bases(100 bases per row)
GATCGGCAATGAGATTCGTACTGCCAGCTTGCCCGATAGAAGCTGCGAACCGACCTGCATCATGACTTCCTTGAAAACTCCTTGCTGGTTTTTGAGTGCC
TCTCGGTCCTGAAACACCAATCCGCCGCGCTTGTTTTGTTTGAAGTGTTCCATCCATTGCATGCGGTCTTTAATCTGCAATTGCGCCCACGAGTCCTGTG
CATTGAGCGTTGGGCGTGGCTGGGTGCTTTCATTCGTCGACTTGTCTCTTGAGCTGGCAGCAGATTCGGTTGCTGCCTTCTGAGCTTCGATGGAGGTGAG
TGAGTTGTGGGGGACGACATTGTCGATATGCAGGCTCACAGCGGAGAGAACGAGGCCATCGTTGCTGAGTTCACGCGCTGACATCTTGAAGTCGAAAGCT
CAATACGCTAATGGATAAAGGCTGGGTTTCTTGTTGGTGAGGTGCGTTGAAAGTTGCGTTGTGCAGTGCCTGGTTGGTTGGTTCCTCGGCTGCCAAGGAA
GAAGCAAGGTGTGTGGTCGGCGACGatcatggagctgctggcagGTGAGTGCGTGGATATTCCTGGTCATACCTGCCTCGTTCTGGCTCcatggcgttgg
tgtcggGCACCAGTGGACGCGCGGACACTAGCCTATTCTTGGGCATCACTCATTTCTCTCGATGCACGTAACGAACTGCTGCGCTAGCCACGTCTTCCTG
TCCTTGACATGTTCGGTTCAGGCCGATTCAGCACATGACCGTCCATGTAAatgcgtcgtcgccatcgaaACTTTGGTGGCAACATTACTCGCTTCGTGTA
GCTTCCACCTCAAGTCATGAGGAAATTAAAGTTATTTGCTAAACGGCTTCAGTTACCCGATCGGAGATTGCAATCTGTCGTGGATCAGCACTTAGGAACA
ACACTTAGGAACAGTAAACTAAATCTATCGCTTTCAGCGGCTTCGTAAGCTTGAGGATCAAGATTTATTAATACAAGTACTTGTACTACAGAGGCGTGGT
TCGTCGTTCTGTGGAGAGTCATCAATCATCGCGCCAGTTTTGATGGTCCTCGGTATGTATATTCAGACGCTAGCTTATAGAAACTTCCCTAGAAGATCAA
CGTCGTTGAAAGTGAGCCACGTGATTTTCCACTTCTCATGTCCTGCAAACGCAAGCGAATACGTATCCTTCCATAGCGACACCGTCTTAGGATATGGATT
GAATTTTGCGATGCTAAAGTAACTTTTTCTTGCACTGTATCAGACAACTACTACTTGAATTACGTAGTACTTGCCTGTTTCCCCTGTTGTGTTGTGTGAG
TGTCATAAAACAATACCCCATCCGTGAGAATAACAGCTTGCGCAATCGGTAACCGGCAATGGTTTTCGATGTACCTACACGAAAGCGATCTTAACTACCA
CACAAATGTGCATAATTCCGATTGAGTATGTCGAATTCGAGCATTTTTCGCTACTTCTCGTGGGTGAAAACTCGAGTCTATTCGTCACCCTACTGTTATT
CCGCTGGCTTAGACGCGTATTCAGCGATTAGTGCCGTGAGTGCGTCATACGTGTAGAGCGACGAAGTGTGGCCATCATTCCACGTGACCGCGAACGCATA
GTTACCCTGATACATAGAGCAGTTAGTGTGTGTTGCTCAAGCTAGAAACGAAGCATACAACTTGACAAACCTTCCGCTCGACTGCGGTGGGGTTGATGTC
ATCTGGAATTGTAGCTGGGTCCAAAATCTGCACAACAACATTGATGTTAAACCAGCAACACCTCGTCCAGTGCCCAGAACAACCGTACCTGCTCTCCAGT
GAACTCATCGATGCATTGAGCACAGCGACATCTGAAATGGATCAAGCGACCAGCCCGTTAGTTACGAAATGCCAGCAAGGAAGCAAAAAATTGGCTCGAG
TGAACTTACTGTGCCCGGAGATCAGCTGGGTGGAGGACAGCCTCCTTTGCCTCGTTTAAACTGTACAAACGGAGGACAATGCCGCGGTTCTTGTCATACA
GCAGCTCAGGCGCCAGACGAACGTTGTGCTTGAAtagcaccagctccttggcaACCTAACAAGACAAGTTAATCAAGGGCCAGCAACACCGACAAGTTAA
CCATAAAAACTACGGACTTACTGTGGTCGCTAGCGAGTCGTAagtcttctcttcctccggGGATAATCCAGACAGAACGAGTGGACTGCAATCACGTAGA
TAGGCAATGTCAGTTCACATATCAAGACATGCATGATTCTACCCGATAATTCACGCACCGTCCAGAATCGCCTGACGAACTGAACTGCTCCGAGATAGgc
agcttgaacacgttTTTCATGTTGTACTTGTCCACAAGCTCTTGTGTGTGACCCGAGCCTGCAAAATTACGTTTAACCAGAAACATAAATGGTCTTGCCA
CAGTGCCAAACAGAATTCGATGAACAACTGACCAAACGGATAGTGCCGCTGTCCATGAGAGCAGTCGAAGTAGGACATGTTCTCCACTACCGCGGCCGTT
TTCACCTACACCATTATCACAGCAGTGTTAGCGACTAGATGCACCCGCGACCAAAGACTGATCTGGCACACCTTTAGGTCGTCAAACATCGCAATTCCTT
TCTCTacgtcgacgaagctgaacaaATCAGAGCCATATTAGACTGTGCACTTAATATGCAACACCAAATCCAGAAAGTAGCGTACGTACCTGAGTCTCTG
CGGTGTTGTCACGACAACTGCAGCTGAGATAGCCATTTGCTGTGAAAGCGATATCTGGATATCTCCCGTTCCTGGCGGCATGTCCACCACCAAATAGTCG
AGGTCGCCCCACTCCGTACCAAGAATGAGCTGATCGACTAGCTTCGAGACCATGGGGCCACGCATCACAGCGGCT