Description :
From Genome Similarity Track
Location :
Scaffold_829:10275- 11289
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_829-fgenesh-gene-0.1Oxidoreductase, Gfo/Idh/MocA family

Sequence
1014 bases(100 bases per row)
GCGGTTCACGCGCTCCGTCTTCTTGGCGTCGTCGAGGATGCGGATCTGGTCGACCACTTCTTCCGGGTTCACCAGAAGCGGCTCACCGGAGCGGATCGCC
GCGGCGATGTTCTTGTAGTAGACCTCGTATGTTCCACGCTTGCTCGGGATCGTCTTGCTCTCGCCGGTAGAACTCGTGAGCGTTCCGAAGTTGCTCTCAG
GCTCCAGGCCGAACCCCTCGTCGCCCGGACGCTTGCCATCACGCAACGACTGCTCCTGGGTGTCCTCACCGTACTTGAGGAACGTGCCGTTTGAGCCTTC
GATGGTGTACTTCGGCGGCAGATCCTTCACCATCATCCCAGCGCTCAGGATGACCTTGAGCTCGGGACGGTCGTTGTACTTGAACTCGAGGTAGAAGTAG
TCATCGTTCTCGGCGCCTTCGCGCTGGATCTGCACGTCCGCGATGACATCATCAGGTGTGCCGAACAGCTGCAGCGCTTGGTCGACCACGTGAGCGCCGA
GGTCGTAGAGGATGCCGCCACCGAGATGAGCCTTCTCCTTCCAGTAACCCTTGAGCTTGGGGCGGTAGCGGTCGAAGTGGGCCTCGTACTTACGCAGCTC
GCCGAGCGTGCCGCCCTCAATGAGGGAGCGCACGGTGAGGAAGTCGCTGTCGAAGCGGCGGTTGTGGAAGACGGAGAAGAGCACGCCGTTGGCCTTGGCG
ATGTCGCACAGCTGCTGCGCCTCGCCCGGCGTGAGGCACAGCGGCTTGTCGCACACCACGTGCTTCTTGGCCTCCATGGCCTGCTTGGCCTGCGCGAAGT
GCACCGTCGTAGGCGTCGAGATGACGATGAGCTCCACGGGCGTGGCCACCAGCTCGTCCATCGAGCGCACGATCGTCGGCGCCGGCGACAGCTCCGCGCT
CTTGCTCGTCGAGCGCTCGAGCACGTGCGTGAGCTCGAACACGCCCGAGCTCATGAGCAGCGGCGCGTGGAAGACGCTCGAGCCGGTGCCGAAGCCCACG
AGGCCGACGGGAAT