Description :
From Genome Similarity Track
Location :
Scaffold_2:1027107- 1032116
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G000812Similar to rfc4: Probable replication factor C subunit 4 (Dictyostelium discoideum)
Pytul_DAOMBR144PYU1_G000811Similar to sec13: Protein transport protein SEC13 (Dictyostelium discoideum)
Pytul_DAOMBR144PYU1_G000810Similar to YPT1: Ras-like GTP-binding protein YPT1 (Phytophthora infestans)

Sequence
5009 bases(100 bases per row)
CATGTTCTCCGCCCGTTCGACCAAGGCCGACGCCATCCCGACGGTGCTGCCCTGGGTCGAGAAGTAGTACGTGAATGCGTCCGTCTCCTGCAGCCAAGTG
AATGTCGTGGCGTGAGTGTCTAACGAGCGTGTGGATTGTGGATTGTGTAGCCGTCCAAAGAACGTGGACGAGATTTCCCACCAGGAGCACGTCGTCGCGA
CGCTGAAGACGTCGATCGCGAGCGGCCAGTTGCCGCATTTGCTGTTCTACGGACCGCCCGGCACGGGCAAGACGTCGACGATCGTCGCTGTGGCGCGGCA
ACTGTTTGGTCCGGATTTCCGCAAGAACGGGCGCTTTCTGGAGCTCAATGCGTCGGATGACCGTGGCATCAGCGTCGTGCGTGAAAAGGTGAAGGGGTTC
GCGCAGGGCGCTATCAGTGGTTCGAGCACGATGCCACCGTTCAAGATCATCGTGCTGGACGAAGCAGATTCGATGACTGGCGACGCGCAGTCGGCGCTGC
GCCGCATGATGGAGAACTACTCGAAGGTCACGCGCTTCTGCCTAATCTGTAACTACGTGAGTCGTATCATCGAGCCCGTGGCGTCGCGTTGTGCGAAATT
CCGTTTTGCGCCGCTCGAGAAAATCTCCATGACGGCGCGCATCCAGTACATTTGCCAAGAGGAACACGTCGAGTCGAGTGACGAAGTGATCGACTCGCTA
CTCGAGTGCTCGAATGGCGACTTGCGTAAAGCCATCAATTTCTTGCAGAGCGCAAAGCAGTTGTGCGGCAACGAACCGCTTTCCAAGGACGACGTCATTG
CTGTGGCTGGTCTGGCGCCTCCTGAGCTCCTGGAGCTTTTCTGGAAATCCGTGGCATCCAACAACTTTGACAAGATGAAAGTCGAGATTGAAAGCATCCT
CATGGCCGGGTACCCAGTACTCACGGTGCTGAAGCAGCTGAGTGACGACGTGCTCACGAATGCCAAGCTCAGTGACACAAAGAAGGCGAAGCTGTGTCTG
CGGATCGCCGAGGCCGACAAGAAGCTTGTCGACGGCGCGAGCGAACACTTCCAGCTCCTGGACGTCGCGTCGTATATCATGCGCGTCTACCACTCGTCGT
GATCCATCCGCTAATATATTGATACAGGAGCAAGAAACACATGCACAACAGAGCGTTGACAAGGGCCGTCATCTAGCATTTTATAACAAGAAAAAAGCAA
GAAATTCCATATGCAGCCCCTCGTTTCAATTTGAATTTCTTCTTCCCTGTAGTTTTCTCTCTCTTTGTTTAACTTTGTAAGCACAATGTCCATGTTTGCT
ACTGCCGTGTAAATGGATTACGAGCTGAGCACCTGCGCGCCGTTTTCAGTCACGGACGAGAGCTGCACCCACTCGTGGTCATTGAGCTGCTTCCAGAACG
TGACTTCATCGTCACCGACAGCGACGCTCAGCACGGTGCCCGTGAGCGACCAGCTTATCCGGTACACGGGGGACCGGAATGTGTGAACGAGCTGCATCTT
CCACTCGCCGTCGATCTCGTCCTGGCTCCAGACGCGCACCGTGTGGTCGTCAGACCCCGACGCGATGAGGTTGGCGGGGATGCCGACGTTCGGGGCCCAT
GCAACATCGCGTACCCAGTCCTCATGGCCGCGAAGCGTGTCGTGGGCCAGTGTCCACTGGTTCTCTTGGGCCGCAAGCTGCCAAATCTGCACGGTCGAGT
TGACGGAGCCAGTGACCACGCGCTGCACAGGACCCTGCGGGCCTTGCGAGCCCAATGAATTATATGGCGCCCAGCTCACCGACGTGACCGCCGCGCTATC
CGGGGAGTTCATAAACGACGACGACGTCACCCACCCTTCTCGCACGCGGGTAAGGAACGACACTTGGCCGTCGGCGGACGCGCTCGCAAGACAGAGACCG
TATTCATAAGGCGCCCATGCGATGCTCAGAACGGCAAGCGAGTGAAGCGTGTGCATGTACTTGAGGCGCCACTCGATCGCACCACTGCCATTCGGATGGA
GCTCTTCGCGGTACACGTACACTCGGCCGTCCTGGCACGCCATCGCGAGCAGGGATCCAAATTTCGGGTGCGCCCACGCGATGCGGTGCATCGGCGCGTT
CGAGTCTTCTGGCAGCTGCACAATATGTTGCAGTACATGAGCACTCGGTGGTGCCGCGTTCGGGTCCGACGACGCGGAGGTCTGCGGCGGGACCGAGGGG
GCCGTGGCTTCCGACACGTCATACACGCGGAACGTGCGGTCGCCCGAGCACGTCACGAGGCGCTTGCCGTAGTAGTCCAGCTGGATGTCGTTGATCATGT
CGTTGTGCTCCGTGTCGATACTCGTGATCGGCGGCGTGCGCTGCTGCGAGGCGTACTCCCCAGCGCCATGAACCCCCGCGTACTCCATCTCGCCCTCCTG
TGTTCGGTCAAATTGATCTCTTTGCGTGATGCCTTTATGCTGCTTGTGAGATGGTATAACCGCGATTTTTTAATAGTGGACTATCTCTGGAAATGCATGA
TCCAAAAAGTGTTCCACAATGGCTTGTGGAACATTATGTAGGGCGTCGTACATTGTCGCTCCACACTTTTTGTATTTGGGATGACTTTATAGAGCAGTGG
GTGTGTAGCTATTTTGGGCTTTTGAAACGTTGTTGACAATTTTGAACAACCACAGCGGCAACAGCAATGCTTGCGATCAATGGGGCAAGCGGACCGACAA
GCCGCCATGAACGCTGCGTGGTCACCGACGCAAAGAAGCAGCAGCGCACCGCGATCGCGAAGCACGACGCGCAAAAGAAAGCGGACGCTTTCTTCAATGT
GCGTGTGCCAGCAGCGCCCGTGAAAAGGCAACTGAAGGCTGCAAAGTCGGCAAGCACATCGTCCGGTAAGACTACAACGAAGTGTTGCGTTTGTTCTGCC
TTGTTGTGCGCTCTACTTTAACGCTATTACCACTGCCCCATGTGTGTGCAGGCACGGAGGGGAATCAGGAGACGCTCGATAAGACGGAATATCTCATTTT
CAAAGTAAGGCAAGCGCATGCATTAATACATGCGCGGCTTTTTATCAAGAGTCTCATAATCTGCTGCTGTTCTTGTTTTGGGATTGCTTCAATAGGGCTG
TCGCATCATATTCAACGGTCGCACGGGAAAAGTGTCGTCGTAAATTCCACGTAGGGCAGCCTTCTTTTGCTAGTTGGGTGAACAATGGCCAGTCGAATGA
ATCTCTTTGTGCCGTTTTTCTCTGTTGCGTGGCAAATTAGATACTACCTCGCGAAACTGGTGCAAGATCACGGTGGCAACGTATGGTGAGAGGTGTCTCG
AGGTTTCAAGCCGCTCTGTCGGATGGATTCTCATGTGGAAATCATGCTCTAACTCTGCCTTATCCACGACTCGCGTGACGCACATGGTCGCTCCAATCTC
AGCGGCGCCAAAGCAGACAAAGTGCTCAAGGTATCTATGTTCATGCCTCCATTTGCAACTCATGCCACACTTTTTCTACCAAGTCTATCGTTGTCCCCCA
TCCATGCGCGTTCAGAAAGCTGGCAAAATCAAAGTCGTCAGCCCAGGTCAGCTAGCAGTGCATCAAGCAAAATGTAGCCATGTTGTGGATCTGCTCGATG
ACTTACTTGGCGTCGCTCTGCCTTTTGTTCTTTTCCGTCAGATTGGATTCTTCAGTCCGTCAAACTTCAAAAGCGGCAGTCCGAGTTGGAGTATCTTCTT
TACAAAGATTCTCAACAGTAACGGCTGCATCCATAGCCCATTGCCCTCCGCACGCACACACAATGTAAACGAGTATTGCTCATGTAGAGAAGAAGAAAAA
CTGATTTTTATATTAGAAAGCGCACACAGCCAGACCAGAGCATTCTCTAGTAGCCGCTGCGCAGTTCCTATCTTGATTTCAGCCAACAGAAAAAAATGCA
AGGAGAAAAAAATAGAGTTTTGATGCTGTTCCTGTTTCGTTTCTTCGAATCCCATGCGCGCCTCAATTTCTTTCTTCTCTCTTCAACCAAAATGAAGCTC
TCATCGCTTTTCTTCTCCACTGGTTGCTTTTCCGTCGAGTACGCATTGGCAATTGTACCCACTCAACCAAGAAAAAAAGAGAAAAATGCAGACGAAATGC
CGACGACTGATGTGGGAGATTCGTAGAACCGCGGAGAACCACAGCAATAAATCATCCGACTGCTTAGCAGCATTTTCCTCCGCCGTTCTGCTGCACGTTT
GTGCCTTGGTTTAGCTTGAGGGTGGGCTTTGGCGCAGTTGGGGCGTTCGCCATTCTCTTCTTGATCTGAGCCGCCATCATCATGAACGCCTTCTCAACGT
TCGCAGCGTTCTTGGCACTCGTCTCCAAAAATTCAATTCCAAGGCTTTCCGCAAACTCCTTGGCTGCCTCCGTGCTGACAACACGCTTGGCAGTCAAATC
GCTCTTGTTACCGACAAGGAGCTTGTTGACGTTTTCACAGGCGTATCTGTTGATTGGGAACAAAAAACACAAGTCAGCACAAAACACTTTGTCTACAAAC
TGCATGAATGGAGTGTAACAAGGTCGTTTACCGATCAATTTCGTGGAGCCATTGCTTGACGTTGTTGAAGGATTCTTGGTCGGTCACATCGTACACCACG
ATAATACCGTGAGCGCCGCGGTAGTAACTGCTAGTAATGGTGCGGAAACGTTCTTGGCCAGCGGTATCCCACTACACAATATAATAGTCAGCTCACACGT
TCATCACGTAATAGCGCATCAACTGTTCTCTGGCTTACAATTTGGAGCTTGATGGTCTTGCCGTCAAGTTCGATCGTGCGAATTTTCTACAAAAATAGTG
AAGCACCAATTCTGTCAGTTTAGCTCGAACAAAAGCAAATATCACCATATTTTTACAACAGAAAGGGTAATGGCCACTTACGAAATCCACACCGATGGTC
GAGATGTAGCTTTCCGTGTACGTGTCGTCGGCGAAACGGAGAAGCAAACACGACTTTCCGACACCGGAGTCACCGATAAGCAAGAGCTTGAACAAGTAGT
CGCTGCACA