Description :
From Genome Similarity Track
Location :
Scaffold_897:10271- 12031
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_897-abinit-gene-0.9Duf667-containing protein

Sequence
1760 bases(100 bases per row)
TCGGTGTCGCTGTACTGTTCGTCCTGGAAAAACACACGGAGCACGCGGCAGTGGCCTGTGATGCGCAGCTGCAAGGTAGTCACGTGCTTTGCCCCAAAAG
CGCGCCGCGTGAGGTCGTGAAGATCCATGCACATGTATCGCCAGCCGGGCTCTCGCCCCATGACCATCGGAAGCTGGCACGTGTCAGCGTCCACCTTGGC
GAGCGACCGCGCGTTCGTGATCCTGAGCTGTCGGTAGCGCTGCTTGTCGTCCAGCACGTCCACCTGGATCTCCACAAAGTGCTCCATGTCCTTTAAGAAA
AGCACGACGTACTGGAAGACATTGCGACACGGAAACACCAGTTCGGCGTCTCGCCCCGTGAGCTGCACGACTTCTTCTTTGACGTCTTCGTCTTCGACGA
TCGTTACGCTGTTGCCGTTCTGCAGAGTTGCGCATTCCTGTTGTGCGCGACGGACTGTAGGGTGGTCTCGCAGTGGGAGCGCTTGGTCTCCGTCATCCTC
GTCTTGACTCTGACCGACGTACATGCCACCTTGGGATGGCATAGCTGGAAGCCCACGTTTTGCGTTGGATGAGAGAGAGGATGCTACAGATCGGAGACGG
GGGAGCAGAGACTCTACGATGACGTCTCCAGGCGAGAAAGATCCATCGCCAATCTTCACAGAGGAGAGAGAGGTCCTTGACGCCGACGAAGATATGGTAC
TCCGAGACATTGGCGGCGTGGTCGTGCGGTTGCTCATTTTTGGTTCTTGATCAGCACCTTCTTGGACGGAGTTTCGCCCTGTCGCGACCCGTCGCGATCT
CTCAGTTTGTCGCCCTTTCGACTCGCACAACGACTTTCCGTGTCAAAACCTCCACTCGCGACGATGTCGAACTTCTTTCTTCAGCACAAAGATCTCTTCG
AGTATGATAAGTTCGTCGGTGGCAGCGGCCACGTGACGTCCTCGACGCCATCGTTTCTTGATCGATACCGAGAATGTGATCGCCAGCAAGCAGCACCTGA
AATGACACAACTTGCGACGATGGGCACCGTGTTTCGACTCGACGCTCATGTGATGCCGCCTCCCGACTTCTTGATTCCAACGTTCGCAGCGCCTTCCACG
TTCGGCTGGTTGGCAAGTCAAACTACGCTTGGGGACCTGAACTTGGAACACACAAGCTGCCCACCGGCGCACTCAACTTCACTCGCACNNNNNNNNNNGA
AGTACGCTTGGCGACCTGGACTTGGAACACACAAGCTGTCCACCAGCGCACTCAACTTCACTCGCACGTGGCTCCCCGATCGCCAACAAGCAACCCGTCT
CTCCCAGTCGGCGAGTGACCGACTTGCTCCCCACTGGCTCTTTCGACAAGCTCGAGGCCGATCGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCG
GCGAAGCAACGTGCCAGTCGAGGGCTTTCGAAGTGCCATACCGAAACTAAACGAGTTACTGATCGACGCGTCGACTCGAGCGGGGCTCGTGGTGCCAACG
AAGCGGCTGGACGACGCCAAGAAAATCGAACTACTCATCGGCTCCAAGTGCGTTGGGCGACTCAGTGCTGCCGCGTCATCCAATCTGCCGCCATCAATCC
GCCACCGACTAGAAGCTTCGGCCGTGGTCCATCAAAGACGGGAGCGTTTGTATGCGCTGTTGAGAGATGACTACGAGCGCTTGACAAAATGAAACTCACG
CTTACTCCATGTTAAGAAAAGCGTCGTCTCCCAAGCCATCGAAGATATTGCTGTCATCAT