Description :
From Genome Similarity Track
Location :
Scaffold_13:102706- 105390
Transcript NameFunction/comments
Aphas_H257_05677Hypothetical protein
Aphas_H257_05678Hypothetical protein

Sequence
2684 bases(100 bases per row)
ATACCGGTGACGTCGTCGGTGATGTCAAAGAAGATGGTGCCGCCAGTGGTCGCCACCATCGCCTGGTTGGCTTTGGCTACGAACGAAGTAACATGCTCGG
CCATTGCATTCCAGCTATATACAATAGCAACCGAAATAGATATATATTTCATAAAAGCATATATATATATATATATATATATATATATAGTCACTCGACT
TACGTGGACGGGTGCTTCAATCCCCCCGCGACCAGCGCGACACTCACCGCCACATCCGCCGCCGACGCGTATTCCACCGAGAAACTCAGCATGATCCTGT
AATATGAAGAGAGTAGTGAATAGATGGTGATATATTTATTCAGTTATTTAAAGAATATAGTAAATAAATAGGAATTCCATTTCAATGGACGCACCGCGTG
TTGTCGTGGATGATGCTCTTGGACACGCCGGAGAAGGGAAACTGGACCAGTCCCATCGATTGCACGTCGCCCTATATATATATATATATTTATATATATC
TGAATATACGACAAGAAGAAATATGAGGATGATGCATCAAGTACGTTGGCCGACGTCTCAAGGTTGAGCTCCGTGTAGCTAGTTTCGTCGGGCTTGGCGC
GCACGATGGTGGACGTGGACGCAGGGAGCCGCTATCAACAGGACAAACGTGACATAGGACGAACTATCAGCCACATGCGTACCGTCAAGGTGCGGGAACC
GATGCTGGCATGGTCAAACGCGTACAAGATGCTCAACCGGCGACTCGACGACGCTATGACGATCGATCCCTCGATGAAGACGAACCAAGAAGCATGGGAT
CATAGGGAGGGGGATACCTGTCTTGGTGAAGCAGACGGTGTACAGCCCGGACTCGCGGACGAGGATGGACGAGTGATTGCCCTTGGACAACGGCCACGCT
TGCACGTCGCGGCCGGACGGCGACGTGAGCCGCACATCGATCGCATCCGTGGCAAGTGGTTCCAAGATCTCAAAGTGAAGAAAGATGTCGCTGTTCACGG
AGCGGGACACCACGTCTTCCTTGTAACAATCCTACCACAATCGCCATCGTGAGCAACTTCTAGGACTCGGCATTCAACCCATCCTCCCTACTTCCTCGGT
ATCGACCAGGTCAAAGACGAAGTACGAGCTTGCATCCACCGACGTGGACTGGAACGCAAGCACGCATGCCCACAGGACCATCAACCACATGCTTCGCGTC
ATGCTGCCGCGTGTGGAAATATTCGAATCCAGCAGTTTGCGGTGGAAATTATCCGGATACGGATTTGTCGTGAAACCTCAATCACACACAATTGACAATG
ATGATAATGCCACTTGGGCTGCCATGGGGGGTGCTGGGCCTTGCATTCATCTGCTGCCTGCTCCCCGCCCGAGGCGTCACGGCCGGGTCTTCCTTCGCCT
TTGACGTGTACGGAGGCCAAGAGGTACTGCGCTCCGTCGTTATGCCACCTTAATCGCTACCTCCGCAGGAGTGCTTTCGCGAAGACATCGTGCTGCGGTC
GTTGCACAGCGACCTGTTTCTCCACTTTGAGCTGCTCGAGCCACGCGGCCCCGCTGACGCTCTCCACGTGAAGCTCCTATCCCCGTCGGGTGTGCCCGTC
ACGACTTGGGCACACGCCACAGCCAACAACACGTCGTTACAACTGCGTGAATCGGGCCTCTACTCGCTCTGCTTTACATCCACCCGTGCGTCTCCATCTC
TCACAAATAGCTCTCATCGCCATGGACTTAGCTGGATCAAAGGCGCATCAACGTGTGCTGTACGTCGCGGACGTCGTGTCCTACGGCACCCGCTCCTTGA
CGGTGCGCGACTCGTCAGTTGCTAGTCCCCACCTACCTCACGGAGCTTTGATGTGTACAGCGAGATCCAACGGTGGTGGCCACGCTGCATCAGCAAACAC
CCGACGAACCGTCTCCGTCCACGCTCACCTTGGCCACCGAACGCGTACGTTGTCCTGACGTGGCATCACGACAGCGACCCACCACCACCACCACTTCATT
ATACTTAGGGCGTCCCAGTCTCCATGGGAGTCGTCGAGTACTCGTTTGCTGGGATATCTCTCCACGCCCTCCACGACAACGCTAGGTCCAATCATCTATT
CTCTATTTACTTCGTTTTCATTAATTTCCCCATACATTCATTCCAATCATCTATTCTTTATTTATTTCATTTAAATGATCTTCCATTGGTTTCCCCATAC
ATTCATTCTTCTTTCATAAACAGAGTGATTGCGTCGTTCGCAGTGGACTTTGCCTCCAAGCCGGGCATCGAAGTCACACTGGCGGCCATCCCCGACCACC
GCCTTGTACATCCGCCCACGTACGTTCATTACTTTGCTAAATATCTCTTGAATGTTTTCAAGAAATAGAGGATCCATTTAATTTGCTTTAAATAACACAT
TCATTTATTTACTCCCTATTAGATGGACGTCCATGGCGACGCACATCGAGTCGTTTTATGACCGCTTGATCTCCAACCACGGTGTGTTGGCGTCCACGGG
CGGCTCGCTCCTGTTTGACATTACCGACGTCGTTCGAGGTACATTCTCCTCATATATATATTAAATAATTTCTTATCTATTTGGTATCGCCTCCACAGCG
GCCACTGCCCAAAGCGAGAGCTTGGCCAAGCAAGCTGGCGACGCCGACCTCGCCACATCTCCTTCCACCGTCGCCTTCTCGGTA