Description :
From Genome Similarity Track
Location :
Scaffold_41:10270- 14811
Transcript NameFunction/comments
Phyin_T30-4PITG_15978Putative uncharacterized protein

Sequence
4541 bases(100 bases per row)
GCCTTGAGACCGCCAAGTGCCATTAGAAAAGACAGTCCGCCATATCCACTTATCCCCGCGGACGCGCCTTCATATCCGTCTGTGCCGACACTAGTACCTC
CGTAGCCACCGTCAGTGTTCTGGCTCTTCGGCAATAGCCAGCCAAACGTCTCCGCCGCCTCCGTCGTCGCATCCACTGTACCACCAGAGAACGCCACAGC
TGCCGCACACAATGCATAGATCGTCTTGCTGATCATCATCTTGGTCGCAATTGGAGTAGCTTGCTTGAGCTGGAGTGACTTGTTGGAGGCAGTCGAAATT
GAAGAGTGAGCTCTAAGGCAGTCCACTGCGAGCAGCCCCAGCGCTCAGACTAGATGGCTGGTAACTCGAACGGAATAATCTGTCCTGCCCGCACGACGTG
TAGTCTAAAGCAGAGGGAATAGCCACTACCATTCCTATGCCACATGATTATCAGGTATTTGTAAGCTACATCGATCTATTTATCAGGTTCAGTGCTAGTA
TAATTAAAGTGTCATTCTCGGATAAGATCTGCGCAAACACGCAGGCAGAGAGACGCATCACAAAAACAGCGAGACCGGATGGTGGCAAAACGGTGAAGCG
GTATGGAATTAAAAGGGACATTACCGATGACGAGAATTCCCGCGGGAATTACAGTTTTGATGCATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGCTCATGTACATTAAATGAAGTACTTTCGC
TGCCTACTTATCAACTCGGCGTGCTTTTTATGTGTCCGGTCCTTATCCCGCAAGGTGTATATACCACGTGCTCGTGATAGCCAGAACATATGCATAGGGC
CACTGTCGCTTTCTCGGTGCATTTGCGTCGTCGTGCTGGCTTACGGTGCTTACGCTTCTGATGTGTCAGTCTATATGACCAAGCAGGTCACTAACTGGAC
ACAGGCCATACTGCAGCGATACAGGTATGCTGAACGCGCGTCTGCTAGCAGTAGCCAACGCGATAAAAAAGCGAAAGAAGGCCAAAATTTTTTCCCCGAG
GGGGGGCACAACCTCCAAAAATTCCCCCTCGCATTTCCAACGCAATCTCTATTTCGGTCATTATGGGCAGGGCACACAAGTACATTATTGCTTACAGCCA
CACCGACTTGCCACGTCCATCTGTACGGTCTGCACTGTCACGCAGTGGTAGTATCTATGTAAACAGCAGCTCATTCGTCGCACGTAGTTCCCACTCAATA
CTGTGGTTTAAATTGTGAGCGCTATAAGAGCTGATGGTACAGATAACATGGTTTTGCGTGTGCCCACGTGAGCGAGGGTACGTGCCATCTACGGTGACGC
GTATACAGATAGGGACGGCCAGCTTGCCGAGGTACACAGTACATACCTCGTGCTAGTTATTATATGAAACGCGCTACGCTCTATAGGTGCGTCAACACGT
TTGGTAGCGCCACAGTCAGCTTACAGTATGTGCGACCCCAAGCCTTGCACCGTCAGCCAGTATACAAAACTATGCGGGGTAAGGGGATATAAGGATGTAT
ATCTAAATCACCTGCTCTTCTGCTTCTTCTTTTGCTCAATGTACCTGACGTTTCGGGCGGTCAGCTTGCGAGGGCGGCTGTGTCTATTTTGCTTCTTGAG
GGCCCATCACCTTCTCGACGTTTGGCAGGCTTTCCTGGCGGCGCACTTCGGTCGAATCAGGTGGTGGAAGCTTTTCCTCCTAGGACTTAACCGGTTTTGG
GCCGTTCTTGCAGGCAATACAGTGTCGCACGCTGCCCCATCCGCTGAATGTACGGAACGCGTAGCCGTACTGCAGCTTCCCGCAGCAGACGCAGCGCGCC
CGGGCATTCGTCGTAGACCGCTGCGGGTTCAGCAGAAGCGGGTCAATCTTCGCCTTGCATTGCTTGCACGTAGGGCCCACCATTTTGCAAACTGTGAGTA
TGTTAGCAAATTATATTGTTTTAACCAATTACTTGCGTCCAAATATTAGCCAATAGCACGGTACTGTAAGGCTGGTATTTATTATTAGACAAAATATTAA
AATGTTTTTAAATATTACAATTTGGCTTTGCTATAATATATTATCAGATTTTTAAGCATATACATACTTTATATGCAATATAAATTGACTAAATTCACTA
TGTACCGTGCGCGCATGCATCTGTCGGGTGTGGTGCACGGGAGCAGATAGCGAAATGCCCGTGCAGCTGCGCGCCTTCATTGCACGGTGGCAGTGGTGAG
TTCCAGGTAAAGTACAAAATATATATATTCGCAAAGTCGCTACAAAAAGCGCTGGTCGTGAAGTCTACTTTAATATTAAAAATACTATCGTCTCTACTTA
AGAAAATGTGTGGAAAATAGCATCGCCGAGATCTTACAAATGCGTCTGTGAAGCTTCCGTTAATTAAATTAATACTATTAATATCGTCTTTACTTTGAAA
AGTGTGTGGAAAATAACATCCCAGAGCTCTTACAGAATACCGGTCTGTGAAGTCTACATTAATAATGATAAATATCTCTATTTGAGAAGTGTGCAGAGCT
CTTAGAAAATAAAGTGGTTAGTGTGCCCGATTTGCAGTATCTGCGCAGCTAGCCTGGCCGTTTGCATCTAATCGATGCGTTTCGTGCTCGGCAGAAATGT
TTACCTTACGTCCAATCGCGAGGGTCTGATCGTGCGACAGATCCAGTCAGTGTCGCAGGTCAGCAGGTATTGACCAATCAGGGCGCGAGTTAATTGCGTC
ACGTTTTTGGATATATTTGTAATTTTGGCATAGTTAAGTCGAGTCAGAAAGGTAGGCGCGGTCGGAAAGATGGGAGGAAACTCTATTGGAAAGGCCGGGT
GTAGCCATGCGAAAAGGCAGGAAAACGCAGCAAGAAAGGAACCGGACGGACTTATTGACAGACGGACGGACACGCTACAAGTTTAGGGGGCGGGAAACTA
GCGCTCTGGGCGCCCGCTCCGCGGACGCTAGGGCATAGTTGGTTGGTGTAGAGAGGGCCGACCACCTCCGCTGCGCTGCAGTGGGCTTAGAATTTCTACT
CAAAGCGAAGCAACATATAGTACATGTATACTGTGAGCTACGTATATTACGGTTCAAAACAACACCGCACACAGTATCCTTAGTGCTCACATGTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCACA
TTCCGCGTTCACATCAGACGGTGTTATATCATCCTCTTCAGGCTTAAGTCACTATATATATAAGGTCTCATATCTACTGGCAGCAAGGGCCGAGTGTTTG
CTGACGCAAATTTGCTCTCAGCCGTAACAGTGTATCGCGTTCTTTGTCGAGATATATCCATAATCCAGTACTAGGGCACTATTCCTTAGAATATGTAACT
ATCAAAATATACTGTTTCCAGTCCATGTTTAAGTACGGGTTTTAATTGTACCGAACTTAAGCTAGTCGTTACTCCTGATTCGGCACGCGCTCGCTGCGTC
GTGTAGGTAGTCTTTTGCGCCGCCTTCCTCTTGTTGGTTGGTAAAGCCACACGAAGTCGATGGTCTCTAACTCCAAGTCGACTCCCTCCCCCACGGGGGG
GGGGGGGGTTGGCGGGCTCCCATGTTAATATGCGATCACCAAACCATTGCACCAGAAAAAACGCTAAATTAATGACACAGCGCTTGGCGTAGAGGTGTTC
TGCATCGTAGAGCTCTTCGTAGGGTTTTGTAAATCTTGAGATGTAGAAGGATCCGTCTACCTTTCGATTGAAGTTCCTAACGTGTTTTTTGCGCTTGTTG
TGCGGCGGCATCTCGATAAAACCAAAATGAGGCTTTACATCTCCAGATGTCAATGTAGATCTTAGCTTATTTTGTCTAAAGCATGATAAGACGAGTTGGG
GACTCTCCTGAATCGCTGCACAATTAGCGTGAATACACGGAAACATTTCATCTTGCCAGTTCCCGCATGTGCATTCTCGAGCTGAAAGAGCAACAAGTTA
TCAAGCGTGAATATGCCCGTGTTGATTTTGAGGACCAAGGTGTTGAACAGAGTAGGCACCTTCCATGAGAGGAGTAAACCTACACATTCCGGCAGCTGTA
GCTCTATCCATGCGTTGTCGCTGAAAAACCGGAACTAAATCTGACTCCTGTTTTTATCGTAGCCAATTTGCCGCTATTTGACGTTTCTCAGATGTAAGCT
CGCTCAGCTTCTTGCAGTACATGTGAAACCCATTGAGAGGCAGATGTGCGTACTTAAACAGTATACTGGATTTCACGTGGCACGACTTACCGGGGCTGTA
CCGTAGTATCGGTGTCAAGTGTCACCTCCTATATTGACCAATCACAGCCGTGAATTGGACCTTGGCCAAGTAGGAATTTGCAGTGTTTTGTCAAGTGCCC
CCCCTTGAAGCCAGTGCGGCATAACTGGAACTACCGCAGCG