Description :
From Genome Similarity Track
Location :
Scaffold_42:10270- 11311
Sequence
1041 bases(100 bases per row)
ATGCCCACTGAGGGCACTATCGTAGGCCCCAAAGAGGATTCGGTTCCAAAAAACCTCATTGTGAGGCACAACAATGCGAGTGGTATCCGCTACATCTGTG
CGATACCACAAAAGGCCATGATCGACGGAATATCGATGTAGACCGGCCAAGGCCGCAAGCGTGCTGGTGATTGACTGTCCTAGTCCTTGTATTCCTCACT
CCCAAGGGCATGAAACTATGCCACACATTGAGGATCCCGTGGATACCACACGAATGAGCTCCTCAATAGCAGACGACAAAGTCGTGACATGAGCAAGCTC
ATAATCAGGTCTGCAAGAGAGGGCATCTGCCAACACATTTTGTTTGCCTGGCTTATACCTCACCTCAAAGTTATATTCCGCAAAGAAGGAAAGCCACCTA
GCCATCCTCTGAGAGAGGTGAGGCGACTGTGTCGCCGTGCGTAATGATGCATGATCCGTGTAGACGACTAATGGCTTGGAGCCAAGCAGGTGAGCTCGAA
ATATGACGCGCATACTTCATAGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTTTCAGCATCTTTCAGCTGACGTGATTCAAATGCGATAACCTCTC
GCGGCCTGCAGCATCTACTTGAAACATGGCACTGCCTATAGCAAAATCGGATGCATCGCAGACAACACTAAAAGGGTACTCAGGATTTGGCAATGCCAAA
ATGGGAGCATAAAGGAGACTCTCCTTTATTGCCCGAAATGCGTCAGCATGGGTGTTGTCCCAGCACCAACCTGTGTCCTTCTTAAGGAGATCATTTAATG
GTCGAGCCATATCAGGGTAATTTTCACTGTATTTGTGTAAGTAATTGGCAAGGCCAAGCCACTTACGCAAGTCTTTTTGATTCTTAGGAATCGGCCAGTC
CACTATAGCCTTGACCTTAGCGGGATCCGCTCTAAGGCCGCGCTTACCAATGAAAAATCCTAGAAAAGGAATCTACTCTGCACCAAAAATGCATTTAGAC
GCGTTGGCGTACAATTTATTAGTGCGCATGCACTCGAGCAC