Description :
From Genome Similarity Track
Location :
Scaffold_104:1027- 5011
Sequence
3984 bases(100 bases per row)
GCCAGGCATCTTCAAGGACAGCAACGCCAATGCTTCCTTCTATACTGTCGCATAGTTGATTTCGTTCGCCTTCAGCGTTCGACTGGTGAAATTAACTGGC
CAGTACATGCCATCATATTCTTGGATCAGGGTCGCTAATGTGACCCACTTGCAGGCATAGACCACAATAACTGGAGTTCAATCTGGGTCGAAATGTCTTA
ACGACAGAGTTGTTGCGTATTCGCTTTGAACATAGTGAAAGTAATTGTAGCCTCTTTCCATCGATATTCTTTTTTCGTCTTCAGACTGCTAGTCTTTATC
CATGCGCTGAGCCCGGCCAATCTCGTGTAAATCCGCTTCTCGAAATTCATACAGCACAGCCGCATATATCACGCAGTCCTCAATGAAACGGGGCTGAAGT
AGTTCAGACTTCCGAAAAAAAGATTGCATTGCCGCAACGTGCTAGGAAATGGGATGTTGACCATCGATTCTAAGTCCTTTAAGTGCGCTTCGAGACCATC
GTACTGGACCTGATGTACTAAATAATAGACCTTGCGATAACTCCAAACACGCTTTGTAAGAACGATCGACAAGTTCCATTTATTGCAAGTTCCTATCAAT
CTCTCCACATTCTTACATATACAATCCCACGTCCTTGCCGGGATAAGAATATCGTCGATGAACGATCTTCGCCCCAGTATGGATGATTGCCGATCCATAT
TCAGTTTACCTTCTTTGTACTTGTCTATCCTCCCTTCTGAGAGCGAACGTTTGGCGATCTTGAGGTATCTATAGATCCATATTCAGTTTACCTTCTTTGT
ACTTGTCTATCCTCCCTTCTGAGAGCGAACCTTTGGCGATCTTGAGGTATCTATAGAGTGCATGGTCAACTAGACGTTGGTATATATGAAGCGCATTCTT
TAGTCCGAAGGAAATTTGAAGCCATTCGAAAATTCCGAATGGTGTGATGAACGTTGATATCCACTTTCTCCACTTGCTCTTTTCCACAACCCAAGAAATC
CTCTTGCCATGTCCAACGAGCAGTACCAAAGGGCTTCGTTTCGATCTTCAAACAGATCGCTGACCAATGGCAGTAGTTAAACCATCAAGCAAATTTACTA
TCCCACTCTGCGATAGTAGATGCATAGACGAATGTTGACTCTATTATTCTTGATGACCACCATTATAAGAAACGCCCACGATGAAGTAAAAGGCTGGATA
ATCTTCGCCGTCAAGAGCCCTTTGATGAGACCGAAAATTTTTCTCCCGATACTTGGGTTCTACTGGCCGAACTCTTTGCGCTATCGGAGAGGCTGTGATT
GCATCTGTATCACAAGTCACGCCGCATGCTTCTAGAATTAACGCATTGACTTCCCTCATGAGGACAAGACGTCCATTTCAAATCAGCGCTCTGAGCTTTC
TGCTAATCTTCCGTGAGCAGGACATTGGGTCATCGATCAGAATGTCGTCAATAGTCACATCTTCTTTCAATGCCGCTACTTCCGGCAGTACTTCTATATG
ATGCTCTACATCCTCAGCAAACAGATCACCGCTCTCGTGATATTAAACTTGTGTCTCTGTGATCTTGTTTTCCTCGACATCTGACGGCATCTCTATATCT
GGGGCTACCTTCATTTTTGCATTACTATTTTTGACTAGTTCACCTACCGGATTGGGACTATTTCTGCACGACCCATAGTCTGGTGGTTGGAGATCGATCC
TGCGAAATTCATTGTTGTCGGCCAAAGCATCTCGTCATGCGAGGTCAAATCAGCAATATCGACCTGTCCTTCTGTTGAAATGTCAGCGTCTTTCTCGTGA
GGTCTTCCTTCAACATCCTGCTGTATCTTCACTGTGTTTACTGGTGGCACGTCCTTGATCTGGCGGTCGGTCGTTTCATGATCTGCTCCAGAGTGACATA
TTTACGATGTTCCACAAGTGGTCCGATCCATTCTTGAGGTGGGTCATTTAGTCGATCCACTATAGCTACATATGCCAGCGTTTGCCATTTTTGATATCAG
CGCGACCCCACTGACACATAGCATGGAATTTTGGTATCATATCGCCTCTCATCTACATTTTCGATATGACAAGTGTGATCAGAATGATCTTATGATCGCT
GAGATTGGTCATCGGGAAACATGTCTTCCTGCCGGGTCCTGCGATCACTGTTGGTACCCAAGTCGGACCTCTCGTACCCACAGCTTTGCGTTAGCATTCT
CGATCTCGACCTTCACGCTCTTGAGTCTCCGGTCGATATTGATACATGTTGATATATCGCTATAATATTCTGTATCTTCGAGTTATATGCATGACACTGT
TCAGAGCGATGAAAACGAACCTCATCCGGCAGACATAGTGTACCGTCGGCCACATCGAGCCGTACCTCGGCGGATACCATGAAATCCATACTCGAAAACG
CTTCTTCATATTGATCTCCCACCCAAACATCGAAACGTTATATACTAGTGATCCAGCGAGAGTGACCTTGATCTTAGTGCATCCTGTCGTCATGTAAATA
TTCGCCAACCCCTATACATTCTTGTCGTTGACTTTTGTCGATAACACCACCAATCTTACGAGTAAAGGCGGTGCCAATGATGAATAATTCAGCACCAGAA
TCGAGTGGCAGGGTCGCTCTTTCGTTTTTTAACTTGCTAATTGATCTCGCCTGCTTGAAACATATCCCAGGCGCGTATTTCTAATAGTCGTGAATTCCCC
ACGAGCGAGTTCGATCTCCATCGTTGGTTCAGACGCGAGTACTCATTGATCTTCTTTGAACTAGAAATTTTAGGAAGATATTGTTATTTCAATTCAGATA
TAATCGATTTCATAGCTTGCTGCATATTCTCGAAAATCCATCTGTCTTTTTCCACAAATGGGAAATATCAGAGCCTAGAACGCTCGGCTCGTACCATATT
CCTATCTGGCGAGCGACCTAGTTTAGCTTATTCTCGACATTCAACATCCCTTCATGTTTAGTGGGTACATACCAGAGGCGGATAATGTTATAGAACTCCC
CCATCAGGCATTTCCCTGGTTCATGCATCGCACCACAAGCCCGGTATACTAAGAACCAATTGTCGGAGGGATGTCCGTTGCGACTATAAATTTAGCGCGT
GAGCCGTTTCCAACATACCAGATCGCCATGTTTGGTCGATTCGCAGTAAGTTCACGGCTTCGTGGGTATACCGAGTCCCCGAAGATCTTGGCGATTGGTA
GGGCCCGTCGACTTCAGGCGTGCCGAAGGGTCCCTCGTTTGCTTTTGCTGATCGGGAGCAGTGGTTACATGGATCAATCTCAAATGATCCCTTGGTTTCG
ATCCTATGAAGTCAGATTCGGACACAAACCTACTTATCGTCCGTTAGGGTCGCCTTCACTGCTCGCGCAGGTTCAGATGGTCCGGAGTTGATGCCACCTT
CCGCCGAAACTTGGACAATCCCATCATTGCCTTCCCATGACGTAGACTCCTTCCTTGTTACTCACACAGCGTCATTTACATCGTTGCTGCGTCTTTCACA
TGCCAGAGCATTAGTTGGTGGGTGAGATCTGGATCGTCCAGAGTATCAATAAGATATTCGATATGTTCCTTGCACTCGGCTGGATATCTGGTCTTCACAG
GTATCTTCGCTTGAATTCCAATCATGTTGATATGGTACATATATCCGAAAGGCATTTTGCCAGGTATTTTCTTCACGTGGTAGAACTGCCGTCTTACCTA
TACTCCATGTACAGAATTCTGCACCAAGAAAATCCCCATTAGATTCTTCCATTTAAATTGTGTTGATCTACTCAATTGGTGATACCAGTAGCAGGACGGT
CCCACCATCAGGTCGTCAAACACCGAACACTTCTCATCATCTGAAGTTTGATCTTGGAGGAATGCCGACTTAACTTTGCCGATCTAGTCCTGCGCTTGAT
CTTCATCCCGATCCTTGTCCAAGAACTCTTTTAACTCCAAAAATACCGATACTCTGATTCTCTGTTAAGTGTGTCACAGATTGC