Description :
From Genome Similarity Track
Location :
Scaffold_35:1027- 4184
Sequence
3157 bases(100 bases per row)
CCCGTACTGGTGATAAGGCTTAAGGCAACCGACGTAGAACGTAGGATGCGTGCGCATCTTATGTGGCAGTTCAATCGTGTATGCGTTGCCTAAGCGGCGC
GGCACACGAAATGGACCGATGAACTTGGGTAGTCACTATGTGTCGAGGTAAGTTTACCGTAGATAGTAGGACTAGGTCACCTTCATTGAATGAAAGAACA
TTTGCCCTTCCATTCTTGCCTGTGTATTTCTTTTATCGGTCCACTGCTTCAGCAATGGAATCTTGCACGAAACGGGCAACCATTTCGCGAGCCAGTATGA
ATTCATCTGCTGACTCGCTGTCTTTGGTTGTAGTGCGCTTGGAGCGCACTGTGGCAGGATCAGTGACCTGGGTAGTAATAGTATCCTCGCTCTTACTTTC
CTCTTATTCACCGAAGTCGATGTGATCGACATCGGCGTCATACGTAGTGACCTCGTGGTCAGTACGTGATGAGTGAGAGCCGAGTTGGCGTTCACTCGAA
TGACTCCCTCCCCACCTCAAACTAGAGCTACACTCTGAAAAGGTGGGTAGGCGTGGGTGGCGCAAGCCATTCACGAAGAACGGTGTATGCGTCGTCGATG
CATGCACCGAGTTGTTGATGGCGAATTCCACCATTGGCAAGAATTCGCTCCAATTCGTAAACGAATGGACATAATGCCGTAGGACTTCCTCAAGAACGCG
GTTTGCACGTTCTGTCTGACCATCTGTTTCAGGGTGGTCAGAGGTCGACATCTGAAGGCGCGTTCCGAGTGTATTGAACACGGATCGCCAGAATTCTGCA
GTGAACCGTGGGTCTCTATCAGAGACGAGTTCACGAGGCAACCCATGAAGACGAAAGATCGTGTCAATAAAAACACGAGCACATGCCGATGCATTGATAG
ATTCAGGTACAGCTACCAGGTGTACCATTTTACTGAATCTATCAACGAACACAAGAATACCTGTATTCTTGTGTGGGTCTGCGGGGAATTCAAAGACAAA
GTCCATTGAGACTGATTCCCAGCATTCTGCCGGAATGGTCAAGGGTTGCAACGGCGCACGAGTGAAGGACCTGCCTTCACTCGTTGACATACTTCGCATG
CACGGACGTACTTTCGCAAGAACTGATACTGGCGGGGACAGTAAAAGTCGTGACTAACTGTGAGATATGTCTTCTCTCGACGATGTCCACCAGTAGGTGC
ATCGTGATACTCATACATGATGCGCAGTCGCAGGTCCCCATGGTCCAGTACGACGACACGAGGCGTGTCGCCGGCAACGGCTGTATACTTCAGTAAGCCA
TTGTGGACTGTATATCTATCCGTGGAGGATCGATGTACTGGGGAAACCTTTTAAGGGATCGACGGATGGTTGCGAGAGATGACCCATCAAACACACCATC
GCCGGATCGTACGCCTTGCGTATGTCTTCGAATGAGGTTGACGACGGGACAATCGACGTCAACACCGCGACAGTGGTCGGACCAGTGTCGGGTTGCGCAG
CCGGTTCGAAATCGGGCCGGCGCGAAAGAGCATCAGCGACGACATTCAGTCGTCCTGGTTTATTCTACGGAGAAGTTATACTCCGCAAAGAACGACAGCC
ACCTCGCCATTCGTTGCGAGAGGTGTGGACTGTTAACGGCTGTGCGTAAGGACGCATGGTCCGTGTATACGATGAAGGGTCTATCACCTAGTAGGTAGAC
CCTGAATTTTGCCAAAGCATACTTCATGGCAAGGAGTTCCTTTTCATGGACTGGGTAGTTACGTTCAGCCGGTTTCAGCTGACGTGACTGATAGCAGACG
ACACGCTCAGCACCGTCTGTGTCATACTGCGATAGTGCACATCCGATGGCAAAATCACTTGCATCGCAGACCACATGAAATGGTCTGTCTTGGTCTGCAA
TCGCCAAAACTGGCGAGCGTATCAAGCTTTGCTTGATACCTTGAAAGAGCGCTGGTAATCAGCACTCCATGCCCACTTCTCGTTCTTTTTCAATGAACGA
GAGAGATGAACAGTCATCTCGGCGTAATTGTGCGAGTATTTGTGCAAATACGCCGCCAGGCCAAGGAACTTTCGAAGTCCTTTTACATCGGTAGGCACCG
GCCAGTCAGTGATCGCCTTGATCTTTTCCAGATCGGGCCGAACGCCGTGCTTACCCACGATACATCTAAGAAGTGGTATTTCGCTTGCAGCAAATATACA
CTTCTTGAGGTTGGCATACAACTTATGCTCACGCATCAGCGTAAGAACCTTTCGGACGTGGAGTTGGTGGACTTCCACATCCGTCTGTCCATCATAGCCC
GGCTATGGACGAACACTTCATCGAAATAGCTAGGTGCGAATTCTTGCACTGATCTCAACAGATTTGTTACACATCTGTTGAACGTAGCAGGGGCATTACT
CAGCCCTTATGGCATTACTAACCACTCCCAAAGCATACCGCTTGGGGTGCTCACTGCTGTATAAGGAATGTCCTTTTCGCGCATAAGGATCTGATAGAAC
CCGTCCATCAGATCCGTCGATGAAAAGATGGTACTCCTTGACATACCATCTATAATGACATCCTTCCTCGGTATCGGCGCTTGAGCCGGTACAGTGGCAG
CATTCAACTTGTTGAAGGCATGTACTATCCGCCATCCTCCTGTGGCCTTTCGGACACAGAAGGTCGGAGAGCTATGTGGGGAAGTAGATTCCCTCACATG
ATCCGCTGCCAAGCGATCGGCAAAGAATTTGTCAATCGCTAGTACTTGTTCACGAGGCAATGGCCATTACTTCATTCCACAGTACTTTGAACGTGGTTTC
AGGTCTATCCCGTGACGAGTACCCTTATCCTTGGGTAACTCGCACAGCACTGTTTCTGGGAACACATCATTCAATTCCATCAAATCATCGTAGAGGATTT
GTCTTGAGCGATTCCCACAATTGGGATGTGTATCGCTCAATCCGAGTCTTCTCATCAAGTACACTCTCGTCCATTGATGAGCTGCTGAGAACCCTTTCGT
TCTCAGCGAATACCATTGCCGACCAAATATCGGTTAACTACTCGTCTTCCGCGACGAGTACGCAAATCTGCTTGACTTTGCCACTACGCAGATCAAGCAA
GAACCTTTTCTGTTCGAGCGTGGGCAATAGAATGATCTCCGAAGTTGTCTTCGGAGG