Description :
From Genome Similarity Track
Location :
Scaffold_110:102680- 106840
Transcript NameFunction/comments
Hyaar_Emoy2809819hypothetical protein

Sequence
4160 bases(100 bases per row)
TATTAACGTCACTATCTATAAAGATATCTAAATGAAGAATCTTTAGGGGCTTCGTTGACACCAGCCACTTCGACTTGTATGTAAGATTAAGCGTACATTG
TAGGACCTCATGTCCTCACAAGATTAAGCGCGCTGTATGACCTCAAGCGCTATGTCGAAGCAGTCTATCGAATAATTCATGCGCAAGATCCATTCCACTA
CGTGAGGTATGTATTAGTGCTTATATTCTGAGCGCTTTAGTTCAGATAAAATGTTTGTAGTAATTTACGTCGACGAAATAATCCTCGCGTGCAGAGACAT
AGATCTACCCGCGGAGATCAAGCGTGTAATTAGTATCCACTTATGCATGGATAATATCGGCGCACTGAACTACTTTCTCGGAAAAGAAAGAAGCGCGGTG
AATAGCCAAAACTTGTTTGGATGCGTCAGACCAAATTAATGCGGTCGATCTTGACCAAGTTTGGCATTCAATACAGCTGACCTGTGAAGGCACCACAAGA
CCAAGGACTTAAGATGACCAGGATCACGTTCGAAGGTGTTTGCAATCACAGCTAAATCATGAAAGACGTACCATTCGAAAGTGCAGTGGCTGCGTTAATG
TACCTGATTGTTGTCACCTGTCCGGACCTTGCTGCATATGTGAATGTATAAGTCAGCTCCCTGCAGACCTATCCCCGATGCGCTGGTAAGCTCTGAACGT
GTTTTCGGTATCCACGAGAATCTGCGGCACATGTAATTTGTTTTTAAGATGCAGAAATGTGATATGGTCGGTTAGGCTGATGCAGACTAGGCAGGTAAGA
TCGAATTTAGACGAAGCACCGGCGAGCAAGCATTCATGATCAATGTTGGCCGCATCAGTCGGCGCAGAAGGAACCGATCACGGTGGCTATCTTTTCGACC
GAAGCCAATTACATGTCTTTGTCGGAAGCTACAAAAGAAAACGTGTGGATAAAATGTTCCTTCATTATCCAGTCGAAATCATGGGTAAAAACCCTCTGAA
TCTTTATGAAGACAGTCAAAGTGCAATTGCATCTGCCATGATTCCTAAATTCCACAAGCGAATTAAGCTGATTGGAAGCCGCTATAATTTCATGTTAGAG
AAGGTTTCGACAGACATGTGGAGCATTTATGATGCTTAATAGAGGACATGAAAGCATAAATGATGCTTAAGCCGATTTTCGCTTCCTAATTTGACCATCT
ACGCGGAAAGCTTATTAAAATGGCGAAGAGTTCGAGTAAGTGTATTGTTGAAGAATGGTCTCAATCCGAAAGCAGAAATCAATGCTATTACACGCCGTAG
TGTTTAGTAATGCGCGATGTGACAATTACAAATGCGCGACTGTATGATTAGTAGTGCGCTCGCTATCTATAGGTTGATGAATTTGAATAATCTTGTAGGC
CTAGAGTAGAAATGAAATTGCGAACTAAGGGCAAGAATGTATTCACTATGGATTTTCCATGTCACCAATGAAGCCACTCTATATAATTTTTAAAAATAAA
AAAGGGAACCGTTAATCTTCCCTCAGTTTCTGGTAAATTTCTCTTAGTTGAACATAACGCTATATGAGTGGCTATTTTACAGACATGCCTCTAGGGTATT
ATATCACTATAACCGGGTTTTCTACATCTAATTGACCTAATTCAGCATAGTTCGAAATTGTTCTTATATGTGCTCTTTATCTTAACATTCAGTCAATCTT
TGCCTATAAAGTTTGCTGACTCGAAGCTTTTACGTCCGCAGATGCTCTCAATCGCTCATTATATATTAAAGGTCTACACTTCTACAACAGCAAGCAATCC
CCATCACGCTTACATGCAAATGCTTTTGCGATAGTGAGTGGTAGACTGCTTCTTTCTTTATTATTCATTTTCAAGCGTATTCAAATCATACATATCGCGT
GCACGCGACGAGTCTAATAAATATTTGTCCTGTTCGTTACTGTGTAGATTCCAATATGCTGTTCCGGATCTGTAAATGTGCAATGTAGGTCCGCATAAGA
GCACGCAGGAGGACATAAAGATGGTCGGGCACAGGGAGCTTATGACCAGCGCGCATGCGTAGCTCAAACGGATGCCCCTGTTATTTACGATGATGTTAAG
GCACTGCAACGAGTGAGATTCTTTACGATAATCTAGTTGCTGGTTCTGCCAATCAAGCCGAGGAAACTGCATGCTCGTGTAAGTAAGGGTCTATCTCAGT
AATTACGAGCTGCAGTGCCTACAGTGTTAGTAGACTCGTACTGGGGAATGCAGTCAAAGTTGTTTTGATTTATAAATTGGTTCCGTTGAGTTATGTAGGT
GTTGATTCGATACAACTTCCACATCGTTGTGCATTGTAATCCACTCTCATGCAACGGTCACATCTTCTTCGCAATTTCTAACGAATTTATTGCATCAGTG
ATGCTGATCGTTGCTTGCTTCGGTTCGATATGATGGGTTTACACTCACTCACATTTTTTGATTTTATGGACGTTGCCTACTGTGGCTAAACGCCGACTAT
GACGTCCACCACACAACATTTTTGCGCAAAAAGGTTCAATTGTATATGACTACGACAAAACTGACTTTTATAATCCAACTGATAGTGATATCGCTCCCTC
TATTCGTGACTCATAAAAGCCAATCATGTAGCGTTATATCAAACTGAGGGGATTTAACCAGAGGACAAAGTTTTAATGAAATTAGCGGTATAGCAATAAA
AACTGCAAAAAAAGGTTTAAAAAGCAGGTTCAAGTAAACTACCTGTTTACTCAAAAAATATTTATATAAATTGTCCGTAAAAACAATTAACGCGTTTGGA
GTATAGAATAGCAAAATATATAGTACGGATTATACCCGCCCCACATCTTTTGCCAAGTTTCGTGACTTTAGCACCACGAGTCGTCCCCATGAACGTCTGC
TTATAAAGGACATAGCCAGAACAGACAATATCACATTACATGAATTGCTAATGGCCAGCATGTTCCACTTGACGACGACTCGAGCCACTTCGCTTACTAG
TTTGGGGTTAACGGCTGGTATTCCGTGCGATTTCTCCATATACGCTATAGCGCGACATACAACAACTGCGTGTAGGTTAGTGAGCGCGCGTTTCCATAAA
TGTCCCTTGCCTTATGTACAAGGCTCAACTATGAAAGCGAAGAGTGTCGATAGGACGACGCAGTCCACAATCACTGGGCCGTACCCTTCGTTCAGCTCCC
TCCTGTACTCCAGCATGTCGTCCACAACCTCATCAACATCTAATTCGTCTATATTCTATCGCCATGATGTTGAACTCGTATTAAATGTGCTGTCTTGAAA
GCGCACATTTGCTATCCTCACAGGATAACCTCACGCGTCAGGTCCAGCGACTTAAAAAGACCCAGCGCATTAAGGCTATCCAGCTTCTCCTCTACAATAT
GTCAATGTCGTAACGCGCACGTTGCCGACATGTATGCACGGTATCTTCGTAGAGATCCTATACAGTAAAAATGAAACCATAGTAGTAGGATAGAGTGGTG
TCACCAAAGTATGATTCGGAAACGATGCTGGACCTCAGCAACCACATCAGCGTCATCGGCCAAACCCACATGTTTGCACCTTGCGTCGAAACAAATAAAC
ATTTGAAGTTTCACCTTCAGATGCCTTCTACGCAAACACAATATTCGCTTGTTTATGCAGACATCTCGCAAATGTGCGCTTTCATTTTAAATGGATCGCG
TTAGCGCTGTAGATCAAGCAGTTGAAAAAAGAGCAGCTTAGCACAAAGGTATCCCCGGACAAGTGCTCTCCTTCATCAGTGTACGCAAATGTAAAGTAGA
GCGCACGGGGATTAGGTAGTTTGTTGCTATCGAATACCAAGATAATGTTTAGCACACTCCTGACCTCCATAGGTCTTATCAATTTTACGCAAGGAGTGCA
AGAGACATATCGGGTCAGCTCGTGAGTATTTTCACGGTAAATGACGATCTGGGTTGCGTAAAGCTTTATCTAATAGGTACCTCCGGGCTTGTATGGGGCT
CTTACCTCATCCGCCAAGAGGACAGTGACCCCTTTGATCAATTACAATTCCAAACGCTACGCCGATTCGCGGCAAGTCCCGATATGTACTAGCGCCTGCT
CCATATGCACTGATCCATTGCCTCCCTTAAAAATCTTGAATTCAAATCTTGAATTTTCCA