Description :
From Genome Similarity Track
Location :
scaffold_583:10267- 12356
Sequence
2089 bases(100 bases per row)
AACCTTTTTTGGTATGTGTGTAGGGCTCCCGTACAATATGATCACGACTACAGCTTTCCGTGAGTTCCTAACTGGTATCTCAGGATCCCCAGGCGCCGGG
ATCCCATCCAGCAAACTCTACAACGACCTTCTTGACAGTCACTACAAGAAGTTTAAGCGGGACGTGTCAAAACTCATCTCAGAAGAACATGACGAGCTTT
ACGGTACGGCGTTTATGACTGTGGAGCACGACCTATGGACGAACAGCTCGAAGAATTGCATTGTAGGTGTTTCGTGCCGTTTCATCGATCGAAACTGGAA
TCTCAGACAGATTGCTCTTCTCGCTCAAGCAAAACCGACGGCCATGATTCCGTATCGGTTGCTGCTGTGATTGACAAGGAATTGAATGCGCGGTACAACC
TCGATGTGAAGAAAGTGGCACGTTTCACGATTTCTGACACAGCTGCAGCAGCGCGGAAAGTATCAAAAGAATTGACACTACTCTCCAGACGGACTGCACC
ATGCACGTACTAAACCTGTGTATCGCGTATGGTATTGGACTCAAAGAAAACTCACGCAGCGAATATGTGAAAGACCCCAGCACACAGCAGTTCGTCAAGA
CGAAGTCCATTGTGACTGAAGGCGGAGAATTTCCTGAAGGTGGGCGACTTATTCGCAAGCTGAGAGCATTAAATAATTATTTTGCCTCGGGAAAATCTAC
AGAACGTATCGCTCGACTGACTGCCGTCCAGGAATTTCACAAACTTCCGGTGCTTTCGGCTATGGTTGACGTGGATGTTCGTGTAGCTTCGCCAATTAAG
CTTTTTCAGCGGTCTATCGTGAACTACTCAGCGTTTCGAGCCTTTTTCCAGAACCACGATGTTCCCTCAAGTGAAAAGGACACGTTTGGTTGTATTTCGC
CTGAAGAATGGGAGCTCGTTGTGCAAATGGAAGCCGTTATGCAGCGGGTCGCCGGGTTAGCATTGGCGGAGGCGCAATCAGCGTCTATTCTATCGTCCAC
TTTGTATGTGGTGCTGCGAGTTGCTTCTGCGCGTATGAATTCGTACAAATTTTCAGCTTATCAGTTGAACGGGCCTCGCACTTCGGCCACGAACGAGAGG
AATTTCGCACGTACTGAGATAACGTTACCGCAATTGTCCGAGTTGGCACAGCGGTGTATCAAACGTACAATCCACCAAATTGCTGCGAGGTTGCCAAAAC
CTTCAGTGGCCATGGGGATGGCGCTGTTGTTAGACCCACGGACGAAAACGGCAGCTAAGAACTATCTTCGCGTGCCAGATTGTGCTGAGGCCGCCACCGA
AGATATATTGGAGAAAGCCAAAGACCTCCGGAAAGAACATCGTGCAATGTACAAGCTAATGAACGCTACAGCTGATTCCGAAACCAATGCAATGGCGTCA
GCGTCCAGTACCCCACAAGGCGACAGCTCTTCAGCTTCAGACGATGAGCTGGAGCTGCTGTACGGCGAGGAAGTTTCTCGCCCCGCACAGGAAAGCGCAG
CTAAGGCAACACTGAAAGCGTAGGCAGATGATATAGTCGAGGAGTGGTTATCGCTACGCGTCGAATGGCAGGACGTCGCGAAGATGCAGTATCCGAACAA
GGCCGAGTGCAAACTGATCCTACCAAAGTTGACCACGTGGAACAGGCTTGGCGCGCGCGTATGGAATGTCGAGAAGTTGTGTCAGCAGATAGACGTGTGT
CGTTGGTTTGCCGACGTCGGGCAGACAAAATATCCTTCCGTCGCGAAGCTAGCACGTGTATGGCTTGGTCGAGGAAACTCCACAGCGTTCCAGGAGCGCG
TATTTTCGACAGATTCACTTGTTATGAGCTGCCTGCGCACAAGGACCGACATCGAACGAGTGCAAGGCAGCTGCTGTTGCGTCACAATCGCTTGGACTCC
AAGTTGGTGCCGCGTATCGAGATCAGTGTCACTGATCTGATTTAGTGACCTCCACCCAATAGCAGTAGCACTGCTATCACCATCAGCCACTGCTATTGCT
ATTAGCAATAGCACTCTATTCAAATGATAATAGCAATAGCAATAACACTGCTATCTAAAATTCTCACTGCTATCGATCCCTGTCCACAA